Previous Contig 003953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS014A04Sequence571003953 (5)gb:HHV6AGNM_24101270.010Human herpesvirus-6 (HHV-6) U1102, variant A DNA, complete virion genome.
JMFS029A12Sequence607003953 (5)gb:AY600438_16172767e-25Lycopersicon esculentum ethylene receptor (ETR4) gene, complete cds.>gb:AF118843
JMFS079D07Sequence617003953 (5)gb:AY600438_16172761e-17Lycopersicon esculentum ethylene receptor (ETR4) gene, complete cds.>gb:AF118843
JMFS086B10Sequence603003953 (5)gb:AY600438_16172765e-11Lycopersicon esculentum ethylene receptor (ETR4) gene, complete cds.>gb:AF118843
JMFS130E04Sequence627003953 (5)gb:HHV6AGNM_24101275e-04Human herpesvirus-6 (HHV-6) U1102, variant A DNA, complete virion genome.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029A12+ GAACGGGACATTCGAGCAGCTG
                      ____________________________________________________________
consensus GAACGGGACATTCGAGCAGCTG
 
. : . : . : . : . : . :
JMFS029A12+ ATGAAGTAAATGAGCTCAATCGGGATGGAAAAATAGGCCACCGCAATCAAAAAGTCGCTA
JMFS079D07+ CAATCGGGATGGAAAAATAGGCCACCGCAATCAAAAAGTCGCTA
JMFS086B10+ TCAAAAAGTCGCTA
                      ____________________________________________________________
consensus ATGAAGTAAATGAGCTCAATCGGGATGGAAAAATAGGCCACCGCAATCAAAAAGTCGCTA
 
. : . : . : . : . : . :
JMFS029A12+ ACTTTTTGGCACTCCAAAATGTTCTCAATGCTCCAAAACCCCTCGTACTCACAATTACAC
JMFS079D07+ ACTTTTTGGCACTCCAAAATGTTCTCAATGCTCCAAAACCCCTCGTACTCACAATTACAC
JMFS086B10+ AC-TTTTGGCACTCCAAAATGTTCTCAATGCTCCAAAACCCCTCGTACTCACAATTACAC
                      ____________________________________________________________
consensus ACTTTTTGGCACTCCAAAATGTTCTCAATGCTCCAAAACCCCTCGTACTCACAATTACAC
 
. : . : . : . : . : . :
JMFS029A12+ CGAGCAAACCCATTATCCGCAGCTGCTACCGCAATGTGGACCGACAAAACCAACAGCTTC
JMFS079D07+ CGAGCAAACCCATTATCCGCAGCTGCTACCGCAATGTGGACCGACAAAACCAACAGCTTC
JMFS086B10+ CGAGCAAACCCATTATCCGCAGCTGCTACCGCAATGTGGACCGACAAAACCAACAGCTTC
JMFS014A04+ ACCGACAAAACCAACAGCTTC
                      ____________________________________________________________
consensus CGAGCAAACCCATTATCCGCAGCTGCTACCGCAATGTGGACCGACAAAACCAACAGCTTC
 
. : . : . : . : . : . :
JMFS029A12+ AACACCGACATCCTCAACATCGTACCTTATATCCTACAT---TTAATCCATTTCTTGGAA
JMFS079D07+ AACACCGACATCCTCAACATCGTACCTTATATCCTACATTCCTTAATCCATTTCTTGGAA
JMFS086B10+ AACACCGACATCCTCAACATCGTACCTTATATCCTACATTCCTTAATCCATTTCTTGGAA
JMFS014A04+ AACACCGACATCCTCAACATCGTACCTTATATCCTACATTCCTTAATCCATTTCTTGGAA
JMFS130E04+ CTACATTCCTTAATCCATTTCTTGGAA
                      ____________________________________________________________
consensus AACACCGACATCCTCAACATCGTACCTTATATCCTACATTCCTTAATCCATTTCTTGGAA
 
. : . : . : . : . : . :
JMFS029A12+ CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
JMFS079D07+ CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
JMFS086B10+ CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
JMFS014A04+ CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
JMFS130E04+ CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
                      ____________________________________________________________
consensus CTCACCAGTGCCACCCGAATCAATCTCGACGAAAAACTTCATAGTTCATACATCCTCCCT
 
. : . : . : . : . : . :
JMFS029A12+ CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
JMFS079D07+ CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
JMFS086B10+ CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
JMFS014A04+ CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
JMFS130E04+ CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
                      ____________________________________________________________
consensus CCTGTCAATCTGAAATTCTCACATCCCCACTTGAAATTGGAAGAGCAGAACAAACCCCAA
 
. : . : . : . : . : . :
JMFS029A12+ GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
JMFS079D07+ GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
JMFS086B10+ GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
JMFS014A04+ GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
JMFS130E04+ GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
                      ____________________________________________________________
consensus GAACATCCACTCCTCAGATCTCATCTTTCACCCCCACAACATCCACACACATATATAAAT
 
. : . : . : . : . : . :
JMFS029A12+ GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
JMFS079D07+ GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
JMFS086B10+ GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
JMFS014A04+ GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
JMFS130E04+ GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
                      ____________________________________________________________
consensus GCATACACATATTTCATACTTCTCCCCCTCGCATTGCTCTCTCAAAACGACAAGAGAAAC
 
. : . : . : . : . : . :
JMFS029A12+ CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
JMFS079D07+ CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
JMFS086B10+ CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
JMFS014A04+ CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
JMFS130E04+ CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
                      ____________________________________________________________
consensus CGCCGTTTTCCCCCAGCACCACCGCCGCCACCGGAGGAGAATCTTCAAAGATCCAGCCGT
 
. : . : . : . : . : . :
JMFS029A12+ ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCG
JMFS079D07+ ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCGTGGCGAGCTTAG
JMFS086B10+ ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCGTGGCGAGCTTAG
JMFS014A04+ ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCGTGGCGAGCTTAG
JMFS130E04+ ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCGTGGCGAGCTTAG
                      ____________________________________________________________
consensus ACACAAACCGGGTACCACATTAGCACCCAGTTTCTGCACTCCAAAGCGTGGCGAGCTTAG
 
. : . : . : . : . : . :
JMFS079D07+ CAGAGCAGGCCAAAAATGGGGGGGTTTTATTCA
JMFS086B10+ CAGAGCAGGCCAAAAATGGGGGGGTTTTATTCACTCCCTACCCATCAAAG
JMFS014A04+ CAGAGCAGGCCAAAAATGGGGGGGTTTTATTCACTCCCTACCCATCAAAGCTGCAGTTCC
JMFS130E04+ CAGAGCAGGCCAAAAATGGGGGGGTTTTATTCACTCCCTACCCATCAAAGCTGCAGTTCC
                      ____________________________________________________________
consensus CAGAGCAGGCCAAAAATGGGGGGGTTTTATTCACTCCCTACCCATCAAAGCTGCAGTTCC
 
. : . : . : . : . : . :
JMFS014A04+ CATACACCCAACCATAAATACACATAAATATTATATTTAGTACACATGAATACTAGATTC
JMFS130E04+ CATACACCCAACCATAAATACACATAAATATTATATTTAGTACACATGAATACTAGATTC
                      ____________________________________________________________
consensus CATACACCCAACCATAAATACACATAAATATTATATTTAGTACACATGAATACTAGATTC
 
. : . : . : . : . : . :
JMFS014A04+ AATGTTT
JMFS130E04+ AATGTTTTGTTTATGTCATTCTCCAAGATTTTACCTAAGCTCTTATGTTATGTAAATAAA
                      ____________________________________________________________
consensus AATGTTTTGTTTATGTCATTCTCCAAGATTTTACCTAAGCTCTTATGTTATGTAAATAAA
 
. : . : . : . : . : . :
JMFS130E04+ TACTGTACTATGTTATACTAGTGTGTATATATATATATATATACATATATATAGAGAGAG
                      ____________________________________________________________
consensus TACTGTACTATGTTATACTAGTGTGTATATATATATATATATACATATATATAGAGAGAG