Previous Contig 003950:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS086B03Sequence634003950 (7)gb:AK176022_18180109e-66Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMFS090A08Sequence620003950 (7)gb:AK176022_18180102e-72Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMFS130B06Sequence626003950 (7)gb:AK176022_18180104e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMFS149B03Sequence623003950 (7)gb:AK176022_18180109e-66Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMSF019P01Sequence411003950 (7)gb:AK176022_18180106e-40Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMSF027N14Sequence644003950 (7)gb:AK176022_18180105e-68Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.
JMSF051O11Sequence654003950 (7)gb:AK176022_18180105e-76Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.754005501 (5)gb:AP004343_18405413e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS090A08+ ATCAGCCAGTTTCCACATTTTCTGATTTC
JMSF051O11+ GGAATGTGCTTCTGCAACCAATCAGCCAGTTCCAACATTTTCTGATTTC
JMSF027N14+ C
                      ____________________________________________________________
consensus GGAATGTGCTTCTGCAACCAATCAGCCAGTTTCCACATTTTCTGATTTC
 
. : . : . : . : . : . :
JMFS090A08+ TCTCAGACTTACCCTCACCAGTGGATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
JMSF051O11+ TCTCAGACTTACCCTCACCAGTGGATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
JMSF027N14+ TCTCAGACTTACCCTCACCAGTGGATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
JMFS149B03+ GATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
JMFS086B03+ GATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
JMFS130B06+ CTGTTTGGCCCACCTCTCAACCTGTC
                      ____________________________________________________________
consensus TCTCAGACTTACCCTCACCAGTGGATAAAAGATACTGTTTGGCCCACCTCTCAACCTGTC
 
. : . : . : . : . : . :
JMFS090A08+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
JMSF051O11+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
JMSF027N14+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
JMFS149B03+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
JMFS086B03+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
JMFS130B06+ GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
                      ____________________________________________________________
consensus GCTTACAGTAGTTATTCCGCTTCCCATAATTGCCTAGACCAATAGCATCAACATCAACTG
 
. : . : . : . : . : . :
JMFS090A08+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
JMSF051O11+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
JMSF027N14+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
JMFS149B03+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
JMFS086B03+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
JMFS130B06+ AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
                      ____________________________________________________________
consensus AATGAATTGAGGCCAAAGCTTGGGCAGTTGCATGATATATTGCCTTTCTTTGTTTAGGTG
 
. : . : . : . : . : . :
JMFS090A08+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMSF051O11+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMSF027N14+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMFS149B03+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMSF019P01+ GGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMFS086B03+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
JMFS130B06+ GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
                      ____________________________________________________________
consensus GTAGATCTGGGAGCTTGGGGTCAATAAAAATGCGCCCTTCCAAATACTCCATTATGTAAA
 
. : . : . : . : . : . :
JMFS090A08+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
JMSF051O11+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
JMSF027N14+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGGAAACTTTAGGGACTGGCACCA
JMFS149B03+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
JMSF019P01+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
JMFS086B03+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
JMFS130B06+ ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
                      ____________________________________________________________
consensus ATGGTGTTCCAATCACACTTGAGTCCGTACACAAACAGAAAACTTTAGGGACTGGCACCA
 
. : . : . : . : . : . :
JMFS090A08+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMSF051O11+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMSF027N14+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMFS149B03+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMSF019P01+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMFS086B03+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
JMFS130B06+ GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
                      ____________________________________________________________
consensus GTGTACAAGTACCCAATGCATGCAGGACCTCATATTCTCTCTCAACAGCATGAGCAGATT
 
. : . : . : . : . : . :
JMFS090A08+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMSF051O11+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMSF027N14+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMFS149B03+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMSF019P01+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMFS086B03+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
JMFS130B06+ GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
                      ____________________________________________________________
consensus GAAGCAGTTCACCAGGAGGTTTCTTTCGTAATACATATTTCTTCACTTCAGTTCCTGAAT
 
. : . : . : . : . : . :
JMFS090A08+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMSF051O11+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMSF027N14+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMFS149B03+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMSF019P01+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMFS086B03+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
JMFS130B06+ GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
                      ____________________________________________________________
consensus GGACCTCAACGAGAAATGTAGGATTTGATTGGCCATGCCCAAACTGAGAAACGGAGAATT
 
. : . : . : . : . : . :
JMFS090A08+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMSF051O11+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMSF027N14+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMFS149B03+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMSF019P01+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMFS086B03+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
JMFS130B06+ GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAAACAAGTAGCGGAGGAGGGCTTCTG
                      ____________________________________________________________
consensus GAGATGGAGAAGGAGGGAAGCCATCGACATGGGCAGACAAGTAGCGGAGGAGGGCTTCTG
 
. : . : . : . : . : . :
JMFS090A08+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGA
JMSF051O11+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
JMSF027N14+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
JMFS149B03+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
JMSF019P01+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
JMFS086B03+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
JMFS130B06+ TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
                      ____________________________________________________________
consensus TGTTAAAGCTCTGAGCCGGATCGACTTGGCCAACGAGATCGGAAGTTCGATGTGCCATGT
 
. : . : . : . : . : . :
JMSF051O11+ CTC
JMSF027N14+ CTCGGATGAAAATACAATCTTCGGAGTTCACAACCCAAGTA
JMFS149B03+ CTCGGATGAAAATACAATCTTCGGAGTTCACAACCCAAGTA
JMSF019P01+ CTCGGA
JMFS086B03+ CTCGGATGAAAATACAATCTTCGGAGTTCACAACCCAAGTATAGAGATCAATAGTCG
JMFS130B06+ CTCGGATGAAAATACAATCTTCGGAGTTCACAACCCAAGTATAGAGATCAATAGTCGCTG
                      ____________________________________________________________
consensus CTCGGATGAAAATACAATCTTCGGAGTTCACAACCCAAGTATAGAGATCAATAGTCGCTG