Previous Contig 003931:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051K05Sequence599003931 (5)sp|Q96372|CC48_CAPAN2e-85Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS128D11Sequence554003931 (5)sp|Q96372|CC48_CAPAN5e-79Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS130E01Sequence626003931 (5)sp|Q96372|CC48_CAPAN9e-95Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS148G05Sequence623003931 (5)sp|Q96372|CC48_CAPAN5e-93Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMSF049F17Sequence713003931 (5)sp|Q96372|CC48_CAPAN8e-99Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049F17+ CACCAACATCATCATAGCCAACTTCATCAAGTCTATCCT
                      ____________________________________________________________
consensus CACCAACATCATCATAGCCAACTTCATCAAGTCTATCCT
 
. : . : . : . : . : . :
JMSF049F17+ CATCCTCCCTCTTCACTGGTTCCCCCTCACAGAATATTTCAGTGTCTGGAGCAACAACAC
JMFS130E01+ ACAGAATATTTCAGTGTCTGGAGCAACAACAC
JMFS148G05+ ATATTTCAGTGTCTGGAGCAACAACAC
                      ____________________________________________________________
consensus CATCCTCCCTCTTCACTGGTTCCCCCTCACAGAATATTTCAGTGTCTGGAGCAACAACAC
 
. : . : . : . : . : . :
JMSF049F17+ AATATTCCCTAGGATCAGTTTCAATGACCTTGAATTCCACACTTCTCATCCCTCCTCTAA
JMFF051K05+ GATCAGTTTCAATGACCTTGAATTCCACACTTCTCATCCCTCCTCTAA
JMFS130E01+ AATATTCCCTAGGATCAGTTTCAATGACCTTGAATTCCACACTTCTCATCCCTCCTCTAA
JMFS148G05+ AATATTCCCTAGGATCAGTTTCAATGACCTTGAATTCCACACTTCTCATCCCTCCTCTAA
JMFS128D11+ CATCCCTCCTCTAG
                      ____________________________________________________________
consensus AATATTCCCTAGGATCAGTTTCAATGACCTTGAATTCCACACTTCTCATCCCTCCTCTAA
 
. : . : . : . : . : . :
JMSF049F17+ CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
JMFF051K05+ CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
JMFS130E01+ CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
JMFS148G05+ CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
JMFS128D11+ CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
                      ____________________________________________________________
consensus CAAGGAAATGGTCTCCTATCCTCAAAGGTCGATATGCTTCCAAAAAGTAAGGTTTCAAAT
 
. : . : . : . : . : . :
JMSF049F17+ ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
JMFF051K05+ ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
JMFS130E01+ ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
JMFS148G05+ ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
JMFS128D11+ ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
                      ____________________________________________________________
consensus ATGATTCAAAAAGATCTCCAGTAACCCCTTCAATTGTATCATCTATGGGAAGTATGTGCA
 
. : . : . : . : . : . :
JMSF049F17+ CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
JMFF051K05+ CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
JMFS130E01+ CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
JMFS148G05+ CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
JMFS128D11+ CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
                      ____________________________________________________________
consensus CGCGCTTCCCATACTTAACATCTGGACACTGGTGTACAGACACAACATCCCCAAGCCGGA
 
. : . : . : . : . : . :
JMSF049F17+ CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
JMFF051K05+ CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
JMFS130E01+ CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
JMFS148G05+ CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
JMFS128D11+ CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
                      ____________________________________________________________
consensus CCCTCAAATTTGTTCGGACAACTTTGTTCATCCTAATCTTTGGCTCTTCACACGCGTCCT
 
. : . : . : . : . : . :
JMSF049F17+ CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
JMFF051K05+ CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
JMFS130E01+ CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
JMFS148G05+ CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
JMFS128D11+ CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
                      ____________________________________________________________
consensus CAGCAAGGGCAATAACCACAGTATCTTTCCTTTTCTTGCCCTTAATCAGAATTGTGTCCC
 
. : . : . : . : . : . :
JMSF049F17+ CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
JMFF051K05+ CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
JMFS130E01+ CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
JMFS148G05+ CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
JMFS128D11+ CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
                      ____________________________________________________________
consensus CGCGGAAGAGCTGGAGCTTCTCCATGGTGGCAGGGTGCAGAGCAACGACAGAGTTATCAT
 
. : . : . : . : . : . :
JMSF049F17+ CGTTAACCGCGTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
JMFF051K05+ CGTTAACCGCCTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
JMFS130E01+ CGTTAACCGCCTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
JMFS148G05+ CGTTAACCGCCTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
JMFS128D11+ CGTTAACCGCCTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
                      ____________________________________________________________
consensus CGTTAACCGCCTCGTCAACGACAAGCCTATTCGGCGCCTTCTTCCTCTCCAAAATCGCTG
 
. : . : . : . : . : . :
JMSF049F17+ TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
JMFF051K05+ TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
JMFS130E01+ TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
JMFS148G05+ TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
JMFS128D11+ TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
                      ____________________________________________________________
consensus TAGAGAAATCCCTCTTAGTACTTTTCGAGTCGGATGACTCGGCCTGGTGACTCATCTTCG
 
. : . : . : . : . : . :
JMSF049F17+ ATCTAGA
JMFF051K05+ ATCT
JMFS130E01+ ATCTAGATTCTTGAACGGGGAAGACGAAATTGAGATATTTCGCAGGAGAAGAAG
JMFS148G05+ ATCTAGATTCTTGAACGGGGAAGACGAAATTGAGATATTTCGCAGGAGAAGAAGCG
JMFS128D11+ ATCTAGATTCTTGAACGGGGAAGACGAAATTGAGATATTTCGCAGGAGAAGAAGCGAGAA
                      ____________________________________________________________
consensus ATCTAGATTCTTGAACGGGGAAGACGAAATTGAGATATTTCGCAGGAGAAGAAGCGAGAA