Previous Contig 003920:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS127F01Sequence626003920 (2)gb:AB009048_15105813e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15E6.
JMFS152D05Sequence595003920 (2)gb:AB009048_15105813e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15E6.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS152D05+ GCTTTCAACTCCTTCCGCTGCCGCCTCACC
JMFS127F01+ TCAACTCCTTCCGCTGCCGCCTCACC
                      ____________________________________________________________
consensus GCTTTCAACTCCTTCCGCTGCCGCCTCACC
 
. : . : . : . : . : . :
JMFS152D05+ ATTTGCNTCAGCCTCTCCACCTCCTTCTCAGCCAAGTCTCTCTCCTGCAAAGCAATCTCT
JMFS127F01+ ATNTGCCTCAGCCTCTCCACCTCCTTCTCAGCCAAGTCTCTCTCCTGCAAAGCAATCTCT
                      ____________________________________________________________
consensus ATTTGCCTCAGCCTCTCCACCTCCTTCTCAGCCAAGTCTCTCTCCTGCAAAGCAATCTCT
 
. : . : . : . : . : . :
JMFS152D05+ TTACTATTCTCAGCAGAACCAGAACCTAATCCTGCCCCCGCTCCGAGGCTTGAACTCTCC
JMFS127F01+ TTACTATTCTCAGCAGAACCAGAACCTAATCCTGCCCCCGCTCCGAGGCTTGAACTCTCC
                      ____________________________________________________________
consensus TTACTATTCTCAGCAGAACCAGAACCTAATCCTGCCCCCGCTCCGAGGCTTGAACTCTCC
 
. : . : . : . : . : . :
JMFS152D05+ TTCCCCGCACTGGACTTCTCCTTCCTCCTCCCTCTACTCTTCTCCACCACCTTGGCCGAA
JMFS127F01+ TTCCCCGCACTGGACTTCTCCTTCCTCCTCCCTCTACTCTTCTCCACCACCTTGGCCGAA
                      ____________________________________________________________
consensus TTCCCCGCACTGGACTTCTCCTTCCTCCTCCCTCTACTCTTCTCCACCACCTTGGCCGAA
 
. : . : . : . : . : . :
JMFS152D05+ TCAGCACTGGCGCTACTACTACTACCACCAGCTCCATCATCTCCACCGTGAACAAGGATA
JMFS127F01+ TCAGCACTGGCGCTACTACTACTACCACCAGCTCCATCATCTCCACCGTGAACAAGGATA
                      ____________________________________________________________
consensus TCAGCACTGGCGCTACTACTACTACCACCAGCTCCATCATCTCCACCGTGAACAAGGATA
 
. : . : . : . : . : . :
JMFS152D05+ TTCCGGCGAATGTTCTCCACCGTCTTCTCCGATTTCACCCTCTTCAACAGAAAGTTCCAC
JMFS127F01+ TTCCGGCGAATGTTCTCCACCGTCTTCTCCGATTTCACCCTCTTCAACAGAAAGTTCCAC
                      ____________________________________________________________
consensus TTCCGGCGAATGTTCTCCACCGTCTTCTCCGATTTCACCCTCTTCAACAGAAAGTTCCAC
 
. : . : . : . : . : . :
JMFS152D05+ ACGGGGATCATGTTCCCACGGCAAATCTTCCTGAGCGAATCCGCCGTCGGCATAGCTGCC
JMFS127F01+ ACGGGGATCATGTTCCCACGGCAAATCTTCCTGAGCGAATCCGCCGTCGGCATAGCTGCC
                      ____________________________________________________________
consensus ACGGGGATCATGTTCCCACGGCAAATCTTCCTGAGCGAATCCGCCGTCGGCATAGCTGCC
 
. : . : . : . : . : . :
JMFS152D05+ GCTTTGCTGGATGCAGTGTATGGACCCAGCGGCCGGTATCCCATCTCTTTCTGAAGCCAT
JMFS127F01+ GCTTTGCTGGATGCAGTGTATGGACCCAGCGGCCGGTATCCCATCTCTTTCTGAAGCCAT
                      ____________________________________________________________
consensus GCTTTGCTGGATGCAGTGTATGGACCCAGCGGCCGGTATCCCATCTCTTTCTGAAGCCAT
 
. : . : . : . : . : . :
JMFS152D05+ TCTAATATTGCCTCCGGCTGAGCCACCGTCGAGCTAGTTGAACTCTGCATTGTCAAACCT
JMFS127F01+ TCTAATATTGCCTCCGGCTGAGCCACCGTCGAGCTAGTTGAACTCTGCATTGTCAAACCT
                      ____________________________________________________________
consensus TCTAATATTGCCTCCGGCTGAGCCACCGTCGAGCTAGTTGAACTCTGCATTGTCAAACCT
 
. : . : . : . : . : . :
JMFS152D05+ GCGGTTTCAAAATTTCTGATAATCCGAACCAATCCAAAACCCTAAATCCTGAATCGAAAC
JMFS127F01+ GCGGTTTCAAAATTTCTGATAATCCGAACCAATCCAAAACCCTAAATCCTGAATCGAAAC
                      ____________________________________________________________
consensus GCGGTTTCAAAATTTCTGATAATCCGAACCAATCCAAAACCCTAAATCCTGAATCGAAAC
 
. : . : . : . : . : . :
JMFS152D05+ AACATATGTATGCATCTATGCTCAA
JMFS127F01+ AACATATGTATGCATCTATGCTCAATGCTTTCAACAGTAGCAACTGGATGGTGGAGCTAC
                      ____________________________________________________________
consensus AACATATGTATGCATCTATGCTCAATGCTTTCAACAGTAGCAACTGGATGGTGGAGCTAC