Previous Contig 003918:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026C03Sequence617003918 (12)sp|O49954|GCSP_SOLTU1e-56Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS040H04Sequence626003918 (12)sp|O49954|GCSP_SOLTU2e-60Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS049F02Sequence619003918 (12)sp|O49954|GCSP_SOLTUe-102Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS100G03Sequence623003918 (12)sp|O49954|GCSP_SOLTU1e-67Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS111G01Sequence630003918 (12)sp|O49954|GCSP_SOLTU5e-81Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS114G10Sequence562003918 (12)sp|O49954|GCSP_SOLTU2e-67Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS116E09Sequence545003918 (12)sp|O49954|GCSP_SOLTU2e-42Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS127E11Sequence631003918 (12)sp|O49954|GCSP_SOLTU1e-55Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS130G05Sequence626003918 (12)sp|O49954|GCSP_SOLTUe-109Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS140A07Sequence626003918 (12)sp|O49954|GCSP_SOLTU1e-61Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS163H11Sequence615003918 (12)sp|O49954|GCSP_SOLTU1e-56Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFS166G03Sequence600003918 (12)sp|O49954|GCSP_SOLTU2e-55Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS130G05+ AGGAACACCAAACCTCTGAGCTG
                      ____________________________________________________________
consensus AGGAACACCAAACCTCTGAGCTG
 
. : . : . : . : . : . :
JMFS130G05+ AACCGACAACAATATCCGCCCNCAATTCACCAGNAGGCTTCAGCATTGTCAGGGCCAACA
                      ____________________________________________________________
consensus AACCGACAACAATATCCGCCCNCAATTCACCAGNAGGCTTCAGCATTGTCAGGGCCAACA
 
. : . : . : . : . : . :
JMFS130G05+ AATCCGATGCCATCACAACCTTCACCCCATGAGCGTGTGCATTCTTAATGAATTCCCCAT
                      ____________________________________________________________
consensus AATCCGATGCCATCACAACCTTCACCCCATGAGCGTGTGCATTCTTAATGAATTCCCCAT
 
. : . : . : . : . : . :
JMFS130G05+ AGTCCAAAACCTCACCCTCGGTCCCAGGATACTGTACCAACACTCCACAAACATCCCCAG
JMFS049F02+ TACCAACACTCCACAAACATCCCCAG
                      ____________________________________________________________
consensus AGTCCAAAACCTCACCCTCGGTCCCAGGATACTGTACCAACACTCCACAAACATCCCCAG
 
. : . : . : . : . : . :
JMFS130G05+ ACTGGTAATCAATACCCTTAAGATCAGCAGTCACTACCTTAAGTTCAAACCCATCAGCTC
JMFS049F02+ ACTGGTAATCAATACCCTTAAGATCAGCAGTCACTACCTTAAGTTCAAACCCATCAGCTC
                      ____________________________________________________________
consensus ACTGGTAATCAATACCCTTAAGATCAGCAGTCACTACCTTAAGTTCAAACCCATCAGCTC
 
. : . : . : . : . : . :
JMFS130G05+ TGGTTTTACAAACATCAATAGTCTGGGGGTGACAATTACTAGCAATAACAAAAGTTTTCT
JMFS049F02+ TGGTTTTACAAACATCAATAGTCTGGGGGTGACAATTACTAGCAATAACAAAAGTTTTCT
                      ____________________________________________________________
consensus TGGTTTTACAAACATCAATAGTCTGGGGGTGACAATTACTAGCAATAACAAAAGTTTTCT
 
. : . : . : . : . : . :
JMFS130G05+ TTTTCCCCTTCTGGATATTATTACACATAGCCATTGCCTCTGCCGCAGCAGTGCCCTCAT
JMFS049F02+ TTTTCCCCTTCTGGATATTATTACACATAGCCATTGCCTCTGCCGCAGCAGTGCCCTCAT
JMFS111G01+ GCCCTCAT
                      ____________________________________________________________
consensus TTTTCCCCTTCTGGATATTATTACACATAGCCATTGCCTCTGCCGCAGCAGTGCCCTCAT
 
. : . : . : . : . : . :
JMFS130G05+ CCAACAAAGATGCATTGGCCATGGGCAAACCGGTAAGATCTGTAATCATGGTCTGATAAT
JMFS049F02+ CCAACAAAGATGCATTGGCCATGGGCAAACCGGTAAGATCTGTAATCATGGTCTGATAAT
JMFS111G01+ CCAACAAAGATGCATTGGCCATGGGCAAACCGGTAAGATCTGTAATCATGGTCTGATAAT
                      ____________________________________________________________
consensus CCAACAAAGATGCATTGGCCATGGGCAAACCGGTAAGATCTGTAATCATGGTCTGATAAT
 
. : . : . : . : . : . :
JMFS130G05+ TTAGCAAGGACTCAAGACGGCCTTGCGAAACCTCAGCCTGGTAGGGAGTATACTGAGTAT
JMFS049F02+ TTAGCAAGGACTCAAGACGGCCTTGCGAAACCTCAGCCTGGTAGGGAGTATACTGAGTAT
JMFS111G01+ TTAGCAAGGACTCAAGACGGCCTTGCGAAACCTCAGCCTGGTAGGGAGTATACTGAGTAT
JMFS114G10+ GCGAAACCTCAGCCTGGTAGGGAGTATACTGAGTAT
JMFS100G03+ CAGCCTGGTAGGGAGTATACTGAGTAT
                      ____________________________________________________________
consensus TTAGCAAGGACTCAAGACGGCCTTGCGAAACCTCAGCCTGGTAGGGAGTATACTGAGTAT
 
. : . : . : . : . : . :
JMFS130G05+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS049F02+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS111G01+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS114G10+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS100G03+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS140A07+ ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS040H04+ AACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS163H11+ TCAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS166G03+ AGGAGGCACAAAGGTATTATAGT
JMFS026C03+ CAGGATCACAGGAGGCACAAAGGTATTATAGT
JMFS127E11+ CAGGATCACAGNAGGCACAAAGGTATTATAGT
                      ____________________________________________________________
consensus ACCAACCCGGGTTTTCCATAACATTCCTCAGGATCACAGGAGGCACAAAGGTATTATAGT
 
. : . : . : . : . : . :
JMFS130G05+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS049F02+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS111G01+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS114G10+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS100G03+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS140A07+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS040H04+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS163H11+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS166G03+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS116E09+ ACGCCAAACCCTTCATGTGCT
JMFS026C03+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
JMFS127E11+ ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
                      ____________________________________________________________
consensus ACCCCATTCCTATATACGACTTGAAAACCTTGTTCTTAGACGCCAAACCCTTCATGTGCT
 
. : . : . : . : . : . :
JMFS130G05+ CGA
JMFS049F02+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS111G01+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS114G10+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS100G03+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS140A07+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS040H04+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS163H11+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS166G03+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS116E09+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS026C03+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
JMFS127E11+ CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
                      ____________________________________________________________
consensus CGATCATTTGAGCCTCGGTGAGGCCCTGATCGAATTTGGAGAACCCCATGGGCTCAATAC
 
. : . : . : . : . : . :
JMFS049F02+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS111G01+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS114G10+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS100G03+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS140A07+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS040H04+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS163H11+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS166G03+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS116E09+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS026C03+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
JMFS127E11+ GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
                      ____________________________________________________________
consensus GAATAGATTGAGGCACGGTTGCATCAATCAGAGCATCGAGGTTCGCGAAGCCGCAAAACT
 
. : . : . : . : . : . :
JMFS049F02+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAA
JMFS111G01+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS114G10+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS100G03+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS140A07+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS040H04+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS163H11+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS166G03+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS116E09+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS026C03+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
JMFS127E11+ CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
                      ____________________________________________________________
consensus CGGACATCTTAGATTGCTCAGCCGGCGTGGCGGAGTTGTGGCGGCGCGGGAAAGTGTCAC
 
. : . : . : . : . : . :
JMFS111G01+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS114G10+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS100G03+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS140A07+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS040H04+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS163H11+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS166G03+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS116E09+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS026C03+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
JMFS127E11+ TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
                      ____________________________________________________________
consensus TGGGTTTCAACGCCTCAACAGAGATGGGGCGAGCCTGGTGAGCGCGAAACCCAATCCCAG
 
. : . : . : . : . : . :
JMFS111G01+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS114G10+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS100G03+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS140A07+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS040H04+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS163H11+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS166G03+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS116E09+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS026C03+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
JMFS127E11+ TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
                      ____________________________________________________________
consensus TAGTAGCGCACGGGTCACGGATCTTACTCTGAAATGGGTGAGCGGTTATCGAGGAAGCGC
 
. : . : . : . : . : . :
JMFS111G01+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS114G10+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS100G03+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS140A07+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS040H04+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS163H11+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS166G03+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS116E09+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS026C03+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
JMFS127E11+ ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
                      ____________________________________________________________
consensus ACCTGGCGGTGGGCCTCAACAATGCAGGGGTCGGCGCTCCGCCGCCACGCGGCTGCTTTG
 
. : . : . : . : . : . :
JMFS111G01+ CTTGGGAAATCAGCCGCCGCAG
JMFS114G10+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCG
JMFS100G03+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS140A07+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS040H04+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS163H11+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS166G03+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS116E09+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS026C03+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
JMFS127E11+ CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
                      ____________________________________________________________
consensus CTTGGGAAATCAGCCGCCGCAGAATCGCCCGGCTGGCCAGCTTTCGAGCGCGATCCATTT
 
. : . : . : . : . : . :
JMFS100G03+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGA
JMFS140A07+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAG-AAAGGCGAAGAA
JMFS040H04+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
JMFS163H11+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
JMFS166G03+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
JMFS116E09+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
JMFS026C03+ GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
JMFS127E11+ GGAAATAACGGGGAAGAAAACGCGAGATTT-ATGTATGAAATCACAGCAAAGGCGAAGAA
                      ____________________________________________________________
consensus GGAAATAACGGGGAAGAAAACGCGAGATTTCTTGTATGAAATCACAGCAAAGGCGAAGAA
 
. : . : . : . : . : . :
JMFS140A07+ GAGAGAGAGAGAGAGAGAGAGAGTTCA
JMFS040H04+ GAGAGAGAGAGAGAGAGAGAGAGTTCAC
JMFS163H11+ GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGGAGTAG
JMFS166G03+ GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGG
JMFS116E09+ GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGGAGTAG
JMFS026C03+ GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGGAGTAG
JMFS127E11+ GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGGAGTAGCTTTGCTGTGCTTTGTTG
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAGAGAGAGTTCACAAAGCTTGGAGTAGCTTTGCTGTGCTTTGTTG