Previous Contig 003916:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006D05Sequence642003916 (4)gb:AF106954_1768397e-104Brassica napus galactinol synthase (GS) mRNA, partial cds.
JMFS127D10Sequence634003916 (4)gb:AF106954_17683971e-93Brassica napus galactinol synthase (GS) mRNA, partial cds.
JMSF008M09Sequence277003916 (4)gb:AF178569_17747162e-28Vitis riparia galactinol synthase (WSI76) mRNA, partial cds.696003916 (4)gb:AF412094_17973476e-61Arabidopsis thaliana At1g56600/F25P12_16 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008M09- AATGTTTTACTTAACCATCAAGATAATTACTCGCACCAGCAGTAAGTTCTT
                      ____________________________________________________________
consensus AATGTTTTACTTAACCATCAAGATAATTACTCGCACCAGCAGTAAGTTCTT
 
. : . : . : . : . : . :
rJMSF008M09- TAATGGCAGATTGTTGATAAACATCGAGATGATTGATACGTTAAATTCTTCCCAACCGTT
                      ____________________________________________________________
consensus TAATGGCAGATTGTTGATAAACATCGAGATGATTGATACGTTAAATTCTTCCCAACCGTT
 
. : . : . : . : . : . :
rJMSF008M09- TGCAATTACCAAAAGCTCCGAAATATCAAGCAAAAACATACATTACGGCGTATATATATA
                      ____________________________________________________________
consensus TGCAATTACCAAAAGCTCCGAAATATCAAGCAAAAACATACATTACGGCGTATATATATA
 
. : . : . : . : . : . :
rJMSF008M09- TATACATACAAGGACCAGAGGCTGCTGATTACGCAGCAGATGGGGCGGCGATGTAACGAA
                      ____________________________________________________________
consensus TATACATACAAGGACCAGAGGCTGCTGATTACGCAGCAGATGGGGCGGCGATGTAACGAA
 
. : . : . : . : . : . :
rJMSF008M09- CAACGCCGGTCTTGGGGAGCACCACCGCCTTGAACTTGTCATCTTCAACCTCAAGCCCGC
                      ____________________________________________________________
consensus CAACGCCGGTCTTGGGGAGCACCACCGCCTTGAACTTGTCATCTTCAACCTCAAGCCCGC
 
. : . : . : . : . : . :
rJMSF008M09- CACCGCCAACTGCCGACGCCGGCGCCGGCGTATTCTTGTAATCCAATGACTCGTCGTTGT
                      ____________________________________________________________
consensus CACCGCCAACTGCCGACGCCGGCGCCGGCGTATTCTTGTAATCCAATGACTCGTCGTTGT
 
. : . : . : . : . : . :
rJMSF008M09- ATACGTCCCACCACTTCTTGACCAGCATCTTGATGTCTTCCCTGTCCATGTTTGCCTCTT
                      ____________________________________________________________
consensus ATACGTCCCACCACTTCTTGACCAGCATCTTGATGTCTTCCCTGTCCATGTTTGCCTCTT
 
. : . : . : . : . : . :
rJMSF008M09- TTCCGGTGAACCTCCACGGCTTCGACCCCGCCGCGCAGTAGTGAACCACCTTCACTTTCT
JMFN006D05+ GCAGTAGTGAGCCACCTTCACTTTCT
                      ____________________________________________________________
consensus TTCCGGTGAACCTCCACGGCTTCGACCCCGCCGCGCAGTAGTGAGCCACCTTCACTTTCT
 
. : . : . : . : . : . :
rJMSF008M09- CCAGCTCCACATTCTCCGGGTGGCGCCACAGCATGGCTAGTACCAGGTTGTACACATTCG
JMFN006D05+ CCAGCTCCACATTCTCCGGGTGGCGCCACAGCATGGCTAGTACCAGGTTGTACACATTTG
                      ____________________________________________________________
consensus CCAGCTCCACATTCTCCGGGTGGCGCCACAGCATGGCTAGTACCAGGTTGTACACATTTG
 
. : . : . : . : . : . :
rJMSF008M09- GGATCGGCTTATAAACGTTTCTGAAAAACATGTTCAAGAAATCTTGTTCGGCGAAAGGAG
JMFN006D05+ GGATTGGCTTGTAAACGTTTCTGAAAAACATGTTCAAGAAATCTTGCTCGGCGAAAGGAG
                      ____________________________________________________________
consensus GGATTGGCTTGTAAACGTTTCTGAAAAACATGTTCAAGAAATCTTGTTCGGCGAAAGGAG
 
. : . : . : . : . : . :
rJMSF008M09- TGGGAGGGGTGATTTTAAGGGTGTTCAAAAGGTCATCATAAGTGGAAAGACTGGGCTCAA
JMFN006D05+ TGGGAGGGGTGAGTTGAAGGGTGTTCAAAAGGTCATCGTAAGTGGAAAGATTGGGCTCAA
JMFS127D10+ AAAAGGTCATCGTAAGTGGAAAGATTGGGCTCAA
                      ____________________________________________________________
consensus TGGGAGGGGTGATTTTAAGGGTGTTCAAAAGGTCATCGTAAGTGGAAAGATTGGGCTCAA
 
. : . : . : . : . : . :
rJMSF008M09- AGACAAACATTCCGGCGTTGAAGTAAAGCGGCGGGCGGGGGCCGA
JMFN006D05+ ACACGAACATTCCGGCGTTGAAGTAAAGCGGCGGGCGGGGGCCGAGCTCCGCCGCCGGCC
JMFS127D10+ ACACGAACATTCCGGCGTTGAAGTAAAGCGGCGGGCGGGGGCCGAGCTCCGCCGCCGGCC
                      ____________________________________________________________
consensus ACACGAACATTCCGGCGTTGAAGTAAAGCGGCGGGCGGGGGCCGAGCTCCGCCGCCGGCC
 
. : . : . : . : . : . :
JMFN006D05+ ACTGGACCTTCTCCGGGCACTGTTGGCAGTATCCGATGTTGTACTGCGGGGTGTGAGTCC
JMFS127D10+ ACTGGACCTTCTCCGGGCACTGTTGGCAGTATCCGATGTTGTACTGCGGGGTGTGAGTCC
                      ____________________________________________________________
consensus ACTGGACCTTCTCCGGGCACTGTTGGCAGTATCCGATGTTGTACTGCGGGGTGTGAGTCC
 
. : . : . : . : . : . :
JMFN006D05+ ATGTCTTCTCGCAGAAGCAGTCCATGACGGCGTAAAAGTAGCCGTCCGGCAGGTCAAACA
JMFS127D10+ ATGTCTTCTCGCAGAAGCAGTCCATGACGGCGTAAAAGTAGCCGTCCGGCAGGTCAAACA
                      ____________________________________________________________
consensus ATGTCTTCTCGCAGAAGCAGTCCATGACGGCGTAAAAGTAGCCGTCCGGCAGGTCAAACA
 
. : . : . : . : . : . :
JMFN006D05+ GGTGGTCAATGTTCTCAAACACCTGAATATCCCCATCCAAGTATATCATCTTGCTATACT
JMFS127D10+ GGTGGTCAATGTTCTCAAACACCTGAATATCCCCATCCAAGTATATCATCTTGCTATACT
                      ____________________________________________________________
consensus GGTGGTCAATGTTCTCAAACACCTGAATATCCCCATCCAAGTATATCATCTTGCTATACT
 
. : . : . : . : . : . :
JMFN006D05+ CCACAAACTCCCAGATAGGGAGCTTGGAGTAGGTGATGACGTAGTACGCCATAGCAAACT
JMFS127D10+ CCACAAACTCCCAGATAGGGAGCTTGGAGTAGGTGATGACGTAGTACGCCATAGCAAACT
                      ____________________________________________________________
consensus CCACAAACTCCCAGATAGGGAGCTTGGAGTAGGTGATGACGTAGTACGCCATAGCAAACT
 
. : . : . : . : . : . :
JMFN006D05+ GGGTGTCGTTCTCCGGCGGGTAAACCGGCTGAATTTCACGGACGATGCAGCCCTGGTTCA
JMSF008M09+ TCCGGCGGGTAAACCGGCTGAATTTCACGGACGATGCAGCCCTGGTTCA
JMFS127D10+ GGGTGTCGTTCTCCGGCGGGTAAACCGGCTGAATTTCACGGACGATGCAGCCCTGGTTCA
                      ____________________________________________________________
consensus GGGTGTCGTTCTCCGGCGGGTAAACCGGCTGAATTTCACGGACGATGCAGCCCTGGTTCA
 
. : . : . : . : . : . :
JMFN006D05+ CCAGTAACCGGCGGTGTTCCTCCGGGACATCCGGCAAGACCGCCACCACGAGCGGGAAAG
JMSF008M09+ CCAGTAACCGGCGGTGCTCCTCCGGGACATCCGGCAAGACCGCCACGACGAGCGGGTAAG
JMFS127D10+ CCAGTAACCGGCGGTGTTCCTCCGGGACATCCGGCAAGACCGCCACCACGAGCGGGTAAG
                      ____________________________________________________________
consensus CCAGTAACCGGCGGTGTTCCTCCGGGACATCCGGCAAGACCGCCACCACGAGCGGGTAAG
 
. : . : . : . : . : . :
JMFN006D05+ CAGAGTTGACCTTCCG
JMSF008M09+ AAGAGTTGACCTTCCGCAGCCCCTTGGCCAGCCCCACCACCCCTTTCACGTAATCCCCAT
JMFS127D10+ CAGAGTTGACCTTCCGCAGCCCCTTGGCCAGCGCCACCACCCCTTTCACGTAATCCCCAT
                      ____________________________________________________________
consensus CAGAGTTGACCTTCCGCAGCCCCTTGGCCAGCGCCACCACCCCTTTCACGTAATCCCCAT
 
. : . : . : . : . : . :
JMSF008M09+ TGCCGGCCAAGAACGTCACGTACGCTCTGCTACACAGGCTAGCAGCCTTCACTACTAAAC
JMFS127D10+ TGCCGGCCAAGAACGTCACGTACGCTCTGCTACACAGGCTAGCAGCGTTCACTACTAAAC
                      ____________________________________________________________
consensus TGCCGGCCAAGAACGTCACGTACGCTCTGCTACACAGGCTAGCAGCGTTCACTACTAAAC
 
. : . : . : . : . : . :
JMSF008M09+ CCCCACC
JMFS127D10+ CGCCACCATCCTCCATTGCATTAGCAGAAGCACTAACGATCTCCGGAGCCATTTTTTCCC
                      ____________________________________________________________
consensus CGCCACCATCCTCCATTGCATTAGCAGAAGCACTAACGATCTCCGGAGCCATTTTTTCCC