Previous Contig 003903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K07Sequence486003903 (3)gb:AK129324_20695550.029Mus musculus mRNA for mKIAA1288 protein.779011112 (2)
JMFF051M12Sequence613003903 (3)629011112 (2)
JMFS125H10Sequence408003903 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051M12+ CATCAAGTGTGAATAACAGAGCCGATTAATTATCTTCTCTATATC
                      ____________________________________________________________
consensus CATCAAGTGTGAATAACAGAGCCGATTAATTATCTTCTCTATATC
 
. : . : . : . : . : . :
JMFF051M12+ ACTGTTGAATCCCGTAGTTACTTCACTCTCAGGCACTAAAGCATTTTGGTAGGTATCCCA
                      ____________________________________________________________
consensus ACTGTTGAATCCCGTAGTTACTTCACTCTCAGGCACTAAAGCATTTTGGTAGGTATCCCA
 
. : . : . : . : . : . :
JMFF051M12+ AACAGTAATGTTCTCTTTCTCAGGCGCTAAAGCAGTTCTTTTATTGTTCGCCAGGATCCG
                      ____________________________________________________________
consensus AACAGTAATGTTCTCTTTCTCAGGCGCTAAAGCAGTTCTTTTATTGTTCGCCAGGATCCG
 
. : . : . : . : . : . :
JMFF051M12+ TTCTTCAACATGCTCAATATCTATTACCACTTGTTTCAAGGTCTGGTGAAGTTTTTCGTT
                      ____________________________________________________________
consensus TTCTTCAACATGCTCAATATCTATTACCACTTGTTTCAAGGTCTGGTGAAGTTTTTCGTT
 
. : . : . : . : . : . :
JMFF051M12+ AGCCTTAGATACATACCCTTTCCCGGTTGCTGCCAAATATACTCCTCTTAGTTTATATTC
                      ____________________________________________________________
consensus AGCCTTAGATACATACCCTTTCCCGGTTGCTGCCAAATATACTCCTCTTAGTTTATATTC
 
. : . : . : . : . : . :
JMFF051M12+ TATTTCATTTTTGTAATATCTTTGGACTGGCTCATGCAGAAAAGTCTTATCCCAAGAGTA
                      ____________________________________________________________
consensus TATTTCATTTTTGTAATATCTTTGGACTGGCTCATGCAGAAAAGTCTTATCCCAAGAGTA
 
. : . : . : . : . : . :
JMFF051M12+ CCCGTCATTCATTTTGGTCTTAAGTTCTTCCAAAAAGGCTTGCATAAAGCAGAGCTTTGC
JMFF005K07+ CCCGTCATTCATTTTGGTCTTAAGTTCTTCCAAAAAGGCTTGCATAAAGCAGAGCTTTGC
JMFS125H10+ TCCAAAAAGGCTTGCATAAAGCAGAGCTTTGC
                      ____________________________________________________________
consensus CCCGTCATTCATTTTGGTCTTAAGTTCTTCCAAAAAGGCTTGCATAAAGCAGAGCTTTGC
 
. : . : . : . : . : . :
JMFF051M12+ AGACAGCAACTCGATTGTTTCAAGCAGCGCCACCATCAATCCTCCGGCATCAAAAATCGA
JMFF005K07+ AGACAGCAACTCGATTGTTTCAAGCAGCGCCACCATCAATCCTCCGGCATCAAAAATCGA
JMFS125H10+ AGACAGCAATTCGATTGTTTCAAGCAGCGCCACCATCAATCCTCCGGCATCAAAAATCGA
                      ____________________________________________________________
consensus AGACAGCAACTCGATTGTTTCAAGCAGCGCCACCATCAATCCTCCGGCATCAAAAATCGA
 
. : . : . : . : . : . :
JMFF051M12+ AAGTAGTTTGGGCTCCACAAGGTCTTGCTCTACTATTTTGATTAGGCTAGTTAGAGCATC
JMFF005K07+ AAGTAGTTTGGGCTCCACAAGGTCTTGCTCTACTATTTTGATTAGGCTAGTTAGAGCATC
JMFS125H10+ AAGTAGTTTGGGCTCCACAAGGTCTTGCTCTACTATTTTGATTAGGCTAGTTAGAGCTTC
                      ____________________________________________________________
consensus AAGTAGTTTGGGCTCCACAAGGTCTTGCTCTACTATTTTGATTAGGCTAGTTAGAGCATC
 
. : . : . : . : . : . :
JMFF051M12+ AAATGCCATTATATTGAACTTCCCTAAAGTGTTTCTGGAACTTAGGTTGA
JMFF005K07+ AAATGCCATTATATTGAACTTCCCTAAAGTGTTTCTGGAACTTAGGTTGA
JMFS125H10+ TAATGCCATTATATTGAACTTCCATAAAGTGTTTATGGAACTTAGGTTGATGACGATGTA
                      ____________________________________________________________
consensus AAATGCCATTATATTGAACTTCCCTAAAGTGTTTCTGGAACTTAGGTTGATGACGATGTA
 
. : . : . : . : . : . :
JMFS125H10+ GATGGAGTAAGTGGATTAGTTTTAGGTGTTGCCTTTATGAAGTAGAGCAGATAATATATG
                      ____________________________________________________________
consensus GATGGAGTAAGTGGATTAGTTTTAGGTGTTGCCTTTATGAAGTAGAGCAGATAATATATG
 
. : . : . : . : . : . :
JMFS125H10+ GAAGCTTGAGGTAATATCAGGTCCAGTGTTTATGAATTGAACCCAGATGAGAGCTATGTA
                      ____________________________________________________________
consensus GAAGCTTGAGGTAATATCAGGTCCAGTGTTTATGAATTGAACCCAGATGAGAGCTATGTA