Previous Contig 003902:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS125F11Sequence576003902 (3)
JMSF005N07Sequence248003902 (3)548004748 (16)pir|T06562|T065628e-33CP12 protein precursor, chloroplast - garden pea>gb:PSCP12_1702097 P.sativum mRN
JMSF034E02Sequence687003902 (3)687010482 (7)gb:AC012329_15375772e-27Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034E02+ AATATGCTTCACTTAAGTACAACCTGAAGCAGAATCCACATAGCCAATTCACCCTTA
                      ____________________________________________________________
consensus AATATGCTTCACTTAAGTACAACCTGAAGCAGAATCCACATAGCCAATTCACCCTTA
 
. : . : . : . : . : . :
JMSF034E02+ TAGACTAGCCCACTAGCATAAGCACAAAACAACAGAGAGAGAGTAGCAAATTTTGTAATA
                      ____________________________________________________________
consensus TAGACTAGCCCACTAGCATAAGCACAAAACAACAGAGAGAGAGTAGCAAATTTTGTAATA
 
. : . : . : . : . : . :
JMSF034E02+ CAGATTTTTAAAAATGCACTCTTTCATACATTCAAATACTCAAATGATGAAAAGAACACT
JMFS125F11+ CATACATTCAAATACTCAAATGATGAAAAGAACACT
                      ____________________________________________________________
consensus CAGATTTTTAAAAATGCACTCTTTCATACATTCAAATACTCAAATGATGAAAAGAACACT
 
. : . : . : . : . : . :
JMSF034E02+ ATGCATCAGAGTAATGCTCAAAAATCTAGAATTTTGCAAAATACTGGTGAAGAGTCACTT
JMFS125F11+ ATGCATCAGAGTAATGCTCAAAAATCTAGAATTTTGCAAAATACTGGTGAAGAGTCACTT
                      ____________________________________________________________
consensus ATGCATCAGAGTAATGCTCAAAAATCTAGAATTTTGCAAAATACTGGTGAAGAGTCACTT
 
. : . : . : . : . : . :
JMSF034E02+ TCAACCCTCGATTTAGAATGAAAAAAATCTGTGAGGAAACCCTTAAAATAGAAAAGCTCT
JMFS125F11+ TCAACCCTCGATTTAGAATGAAAAAAATCTGTGAGGAAACCCTTAAAATAGAAAAGCTCT
                      ____________________________________________________________
consensus TCAACCCTCGATTTAGAATGAAAAAAATCTGTGAGGAAACCCTTAAAATAGAAAAGCTCT
 
. : . : . : . : . : . :
JMSF034E02+ TTATACATTCCATAAAAAATCAAAACATCACAAAAGATTCGAGCTTTATTTGTGAATATT
JMFS125F11+ TTATACATTCCATAAAAAATCAAAACATCACAAAAGATTCGAGCTTTATTTGTGAATATT
                      ____________________________________________________________
consensus TTATACATTCCATAAAAAATCAAAACATCACAAAAGATTCGAGCTTTATTTGTGAATATT
 
. : . : . : . : . : . :
JMSF034E02+ GAAGAACAGACCAAAATTGAGCCGACAATGCAAAAGCACGCAGCAAATTAAGAAAAAAAA
JMFS125F11+ GAAGAACAGACCAAAATTGAGCCGACAATGCAAAAGCACGCAGCAAATTAAGAAAAAAAA
                      ____________________________________________________________
consensus GAAGAACAGACCAAAATTGAGCCGACAATGCAAAAGCACGCAGCAAATTAAGAAAAAAAA
 
. : . : . : . : . : . :
JMSF034E02+ AGTGACGAACGCACACAAATGGAGAAACTGTAACTTCTCTCGAAATAATCAGCACAGCAT
JMSF005N07+ ATACAAATGGAGAAACTGTAACTTCTCTCGAAATAATCAGCACAGCAT
JMFS125F11+ AGTGACGAACGCACACAAATGGAGAAACTGTAACTTCTCTCGAAATAATCAGCACAGCAT
                      ____________________________________________________________
consensus AGTGACGAACGCACACAAATGGAGAAACTGTAACTTCTCTCGAAATAATCAGCACAGCAT
 
. : . : . : . : . : . :
JMSF034E02+ TTGCAGCCACCCTAGAAGTTGAGCTAAAGAGAGAACAATGGCGTGACTGAGCTGACGTTG
JMSF005N07+ TTGCAGCCACCCTAGAAGTTGAGCTAAAGAGAGAACAATGGCGTGACTGAGCTGACGTTG
JMFS125F11+ TTGCAGCCACCCTAGAAGTTGAGCTAAAGAGAGAACAATGGCGTGACTGAGCTGACGTTG
                      ____________________________________________________________
consensus TTGCAGCCACCCTAGAAGTTGAGCTAAAGAGAGAACAATGGCGTGACTGAGCTGACGTTG
 
. : . : . : . : . : . :
JMSF034E02+ TTCGATTCCCTCACGTCGGTTCAACGAGTTGGGATTCCTAAACGTAGAAGTGTAGAGGAT
JMSF005N07+ TTCGATTCCCTCACGTCGGTTCAACGAGTTGGGATTCCTAAACGTAGAAGTGTAGAGGAT
JMFS125F11+ TTCGATTCCCTCACGTCGGTTCAACGAGTTGGGATTCCTAAACGTAGAAGTGTAGAGGAT
                      ____________________________________________________________
consensus TTCGATTCCCTCACGTCGGTTCAACGAGTTGGGATTCCTAAACGTAGAAGTGTAGAGGAT
 
. : . : . : . : . : . :
JMSF034E02+ CTGGATAAAATACCTGAGATTCGGTTGGTGTCGAAGCAGAATTATTAGATTTGTTCGAGC
JMSF005N07+ CTGGATAAAATACCTGAGATTC
JMFS125F11+ CTGGATAAAATACCTGAGATTCGGTTGGTGTCGAAGCAGAATTATTAGATTTGTTCGAGC
                      ____________________________________________________________
consensus CTGGATAAAATACCTGAGATTCGGTTGGTGTCGAAGCAGAATTATTAGATTTGTTCGAGC
 
. : . : . : . : . : . :
JMSF034E02+ TCCTCTGACGGGGACTGTCTCGTGCTCCT
JMFS125F11+ TCCTCTGACGGGGACTGTCTCGTGCTCCTGATTGATGTGGATTTGGGCGAATCTAGGGTT
                      ____________________________________________________________
consensus TCCTCTGACGGGGACTGTCTCGTGCTCCTGATTGATGTGGATTTGGGCGAATCTAGGGTT