Previous Contig 003896:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS122C03Sequence579003896 (2)pir|H96597|H965971e-39hypothetical protein T5A14.5 [imported] - Arabidopsis thaliana>gb:AE005173_89343
JMFS125C07Sequence563003896 (2)pir|H96597|H965972e-30hypothetical protein T5A14.5 [imported] - Arabidopsis thaliana>gb:AE005173_89343

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS122C03+ TAACATTA
                      ____________________________________________________________
consensus TAACATTA
 
. : . : . : . : . : . :
JMFS122C03+ CGCCTGTCTGTAGAAGAATCTATGTTCAAATCACTCATAAGTTTGAGAGGCTTCCAGAGA
                      ____________________________________________________________
consensus CGCCTGTCTGTAGAAGAATCTATGTTCAAATCACTCATAAGTTTGAGAGGCTTCCAGAGA
 
. : . : . : . : . : . :
JMFS122C03+ GCTGCTCTGCTACTGCTAGTTGTGCATTCACTGTGTCACGTAAGCTGTGCAAGGACTGGA
                      ____________________________________________________________
consensus GCTGCTCTGCTACTGCTAGTTGTGCATTCACTGTGTCACGTAAGCTGTGCAAGGACTGGA
 
. : . : . : . : . : . :
JMFS122C03+ CATTCCTTCCTTGCCCATGCTTGCTTTGGGAAGCTCTACGATTCATTTGCATCCCATCAC
JMFS125C07+ ACGATTCATNTGCATCCCATCAC
                      ____________________________________________________________
consensus CATTCCTTCCTTGCCCATGCTTGCTTTGGGAAGCTCTACGATTCATTTGCATCCCATCAC
 
. : . : . : . : . : . :
JMFS122C03+ TTCCACCAAAAGTATTTAGTTCAAGAATGTTGAAGTGCCTTTCCAACTCAATGAGTTGAT
JMFS125C07+ TTCCACCAAAAGTATTTAGTTCAAGAATGTTGAAGTGCCTTTCCAACTCAATGAGTTGAT
                      ____________________________________________________________
consensus TTCCACCAAAAGTATTTAGTTCAAGAATGTTGAAGTGCCTTTCCAACTCAATGAGTTGAT
 
. : . : . : . : . : . :
JMFS122C03+ TGGTTAAGACCTTGTTCATATCTCTTATATGTTCCTGCTTCAAGTCAAGTTCAGAACTTA
JMFS125C07+ TGGTTAAGACCTTGTTCATATCTCTTATATGTTCCTGCTTCAAGTCAAGTTCAGAACTTA
                      ____________________________________________________________
consensus TGGTTAAGACCTTGTTCATATCTCTTATATGTTCCTGCTTCAAGTCAAGTTCAGAACTTA
 
. : . : . : . : . : . :
JMFS122C03+ ATTTCTGGCGACTCCAGAGATCCAAATATCGGCTATCAGTGGCCTGCTTGAGAATGCCCT
JMFS125C07+ ATTTCTGGCGACTCCAGAGATCCAAATATCGGCTATCAGTGGCCTGCTTGAGAATGCCCT
                      ____________________________________________________________
consensus ATTTCTGGCGACTCCAGAGATCCAAATATCGGCTATCAGTGGCCTGCTTGAGAATGCCCT
 
. : . : . : . : . : . :
JMFS122C03+ CCATGTATACTTTCTTTGCCAAAACTTTTACTGTCTTATCAAGGAGGAGCTGGATCTCTC
JMFS125C07+ CCATGTATACTTTCTTTGCCAAAACTTTTACTGTCTTATCAAGGAGGAGCTGGATCTCTC
                      ____________________________________________________________
consensus CCATGTATACTTTCTTTGCCAAAACTTTTACTGTCTTATCAAGGAGGAGCTGGATCTCTC
 
. : . : . : . : . : . :
JMFS122C03+ CTTGCCGCTCATCCATTATTCCCCTCCACAGCCTGCACCTATCAGAAAGAGCCTGTATGC
JMFS125C07+ CTTGCCGCTCATCCATTATTCCCCTCCACAGCCTGCACCTATCAGAAAGAGCCTGTATGC
                      ____________________________________________________________
consensus CTTGCCGCTCATCCATTATTCCCCTCCACAGCCTGCACCTATCAGAAAGAGCCTGTATGC
 
. : . : . : . : . : . :
JMFS122C03+ CTTTTTCTAAATTTATAACTGAATTCTTCTGGCTAGCAATGGATGCATTCATAAAACCCC
JMFS125C07+ CTTTTTCTAAATTTATAACTGAATTCTTCTGGCTAGCAATGGATGCATTCATAAAACCCC
                      ____________________________________________________________
consensus CTTTTTCTAAATTTATAACTGAATTCTTCTGGCTAGCAATGGATGCATTCATAAAACCCC
 
. : . : . : . : . : . :
JMFS122C03+ CTTCACCTTCTATCCCTTCTAGAAGGTCATC
JMFS125C07+ CTTCACCTTCTATCCCTTCTAGAAGGTCATCCAGTTTTCTGGCCATTTCTTCAACACTGC
                      ____________________________________________________________
consensus CTTCACCTTCTATCCCTTCTAGAAGGTCATCCAGTTTTCTGGCCATTTCTTCAACACTGC
 
. : . : . : . : . : . :
JMFS125C07+ GAAACTGCTTGGACGGTATTCTTTCAGAAGTATCTCTTGCAGGTTGAAGCTTTGAAGGCT
                      ____________________________________________________________
consensus GAAACTGCTTGGACGGTATTCTTTCAGAAGTATCTCTTGCAGGTTGAAGCTTTGAAGGCT
 
. : . : . : . : . : . :
JMFS125C07+ TTTGCAATGAAATGTTTTGCTGCAACGAAGATGATGACTTAATGCTCTCAGCCCAAGGCA
                      ____________________________________________________________
consensus TTTGCAATGAAATGTTTTGCTGCAACGAAGATGATGACTTAATGCTCTCAGCCCAAGGCA