Previous Contig 003895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS082H03Sequence599003895 (9)gb:AY255521_15931245e-25Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMFS098F08Sequence642003895 (9)gb:AY255521_15931244e-48Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMFS105B06Sequence623003895 (9)gb:AY255521_15931244e-30Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMFS112A04Sequence627003895 (9)gb:AY255521_15931249e-53Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMFS125C06Sequence560003895 (9)
JMSF003N17Sequence288003895 (9)666013830 (5)gb:AY255521_15931242e-74Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMSF030M11Sequence681003895 (9)gb:AY255521_15931241e-35Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.769013830 (5)gb:AY255521_15931244e-76Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMSF036P18Sequence679003895 (9)gb:AY255521_15931242e-34Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.715013830 (5)gb:AY255521_15931246e-84Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.
JMSF049H10Sequence358003895 (9)711013830 (5)gb:AY255521_15931241e-65Gossypium hirsutum ABC transporter (WBC1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS112A04+ ACGT
                      ____________________________________________________________
consensus ACGT
 
. : . : . : . : . : . :
JMFS112A04+ ATGCCGCAGTTCCGAAGGAGAGCTTGGCTTTGTGGCCGTTGAGGACGATTCTGCCGGAGA
JMFS098F08+ GCTTGGCTTTGTGGCCGTTGAGGACGATTCTGCCGGAGA
                      ____________________________________________________________
consensus ATGCCGCAGTTCCGAAGGAGAGCTTGGCTTTGTGGCCGTTGAGGACGATTCTGCCGGAGA
 
. : . : . : . : . : . :
JMFS112A04+ GGAAAGCGTTGGCGGCGAGGCGGCCGGAGAGGGCGTCGAGGAGAGTAGATTTGCCGGAGC
JMFS098F08+ GGAAAGCGTTGGCGGCGAGGCGGCCGGAGAGGGCGTCGAGGAGAGTAGATTTGCCGGAGC
JMSF030M11+ GAGAGGGCGTCGAGGAGAGTAGATTTGCCGGAGC
JMSF036P18+ GTCGAGGAGAGTAGA-TTNCCGGAGC
                      ____________________________________________________________
consensus GGAAAGCGTTGGCGGCGAGGCGGCCGGAGAGGGCGTCGAGGAGAGTAGATTTGCCGGAGC
 
. : . : . : . : . : . :
JMFS112A04+ CGGAAGGTCCCATGAGGGCGGTGAAGGTTCCAGGCTCTGCATACCCGACGAGACCTTCCA
JMFS098F08+ CGGAAGGTCCCATGAGGGCGGTGAAGGTTCCAGGCTCTGCATACCCGACGAGACCTTCCA
JMSF030M11+ CGGAAGGTCCCATGAGGGCGGTGAAGGTTCCAGGCTCTGCATACCCGACGAGACCTTCCA
JMFS105B06+ TGAGGGCGGTGAAGGTCCCAGGCTCTGCATACCCGACGAGACCTTCCA
JMFS082H03+ GCATACCCGACGAGACCTTCCA
JMSF036P18+ CGGAAGGTCCCATGAGGGCGGTGAAGGTTCCAGGCTCTGCATACCCGACGAGACCTTCCA
                      ____________________________________________________________
consensus CGGAAGGTCCCATGAGGGCGGTGAAGGTTCCAGGCTCTGCATACCCGACGAGACCTTCCA
 
. : . : . : . : . : . :
JMFS112A04+ GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
JMFS098F08+ GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
JMSF030M11+ GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
JMFS105B06+ GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
JMFS082H03+ GAACATTCTGGGTTTCTCCATGNCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
JMSF036P18+ GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
                      ____________________________________________________________
consensus GAACATTCTGGGTTTCTCCATTGCCGAGAGTAACCATAACCGTTAAATCCTTCCATGCCA
 
. : . : . : . : . : . :
JMFS112A04+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
JMFS098F08+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
JMSF030M11+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
JMFS105B06+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
JMFS082H03+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
JMSF036P18+ GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
                      ____________________________________________________________
consensus GCCTGGCGGAGACGTCTCCCATGAACTCCGTGTTAGTTTTCTCCTTCCACAGCGTCTCGC
 
. : . : . : . : . : . :
JMFS112A04+ TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
JMFS098F08+ TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
JMSF030M11+ TGAGAGGACTCAACCCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
JMFS105B06+ TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
JMFS082H03+ TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
JMSF036P18+ TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
                      ____________________________________________________________
consensus TGAGAGGACTCAA-CCCCCCAACCACTATCCCATTCCCTTGCGGCTTGCTCGCCTCTATC
 
. : . : . : . : . : . :
JMFS112A04+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
JMFS098F08+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
JMSF030M11+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
JMFS105B06+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
JMSF049H10+ CCGCCGCCGTCGAGTTTCTCATCCTC
JMFS082H03+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
JMSF036P18+ TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
                      ____________________________________________________________
consensus TCCATCATCACCTCCCCCGCCACCGACGAAGACGCCGCCGCCGTCGAGTTTCTCATCCTC
 
. : . : . : . : . : . :
JMFS112A04+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMFS098F08+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMSF030M11+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMFS105B06+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMSF049H10+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMFS082H03+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMSF003N17+ CTCCGAAGC
JMSF036P18+ GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
JMFS125C06+ TCTCCCCAATACTCCGAAGC
                      ____________________________________________________________
consensus GCACTCATTCGTAATATTCGATCTTCAACAACTTAACTAATCTCCCCAATACTCCGAAGC
 
. : . : . : . : . : . :
JMFS112A04+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMFS098F08+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMSF030M11+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMFS105B06+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMSF049H10+ ATAAATAAGCTCGATATGATCTCTGCNGGCAAGTTCCGCACTNGTAGAAGTNGAATCACT
JMFS082H03+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMSF003N17+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMSF036P18+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
JMFS125C06+ ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
                      ____________________________________________________________
consensus ATAAATAAGCTCGATATGATCTCTGCAGGCAAGTTCCGCACTTGTAGAAGTTGAATCACT
 
. : . : . : . : . : . :
JMFS112A04+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMFS098F08+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMSF030M11+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMFS105B06+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMSF049H10+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMFS082H03+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMSF003N17+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMSF036P18+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
JMFS125C06+ GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
                      ____________________________________________________________
consensus GCAAATACGAACTGAACAGAAAGAAAGAAACGAGATGCGTATGAATGGAAGATGAGATTG
 
. : . : . : . : . : . :
JMFS112A04+ CCGTGAGTTTGACTGATGAGAGAA
JMFS098F08+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMSF030M11+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMFS105B06+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMSF049H10+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTN
JMFS082H03+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMSF003N17+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMSF036P18+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
JMFS125C06+ CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
                      ____________________________________________________________
consensus CCGTGAGTTTGACTGATGAGAGAAGCTTGAAAGGACGTTAATGGAAATCTCTGTAGCTTC
 
. : . : . : . : . : . :
JMFS098F08+ TCAG
JMSF030M11+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
JMFS105B06+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
JMSF049H10+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCNTCCGATCCGCAGGTCAGGTTTGGTTTT
JMFS082H03+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
JMSF003N17+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
JMSF036P18+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
JMFS125C06+ TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
                      ____________________________________________________________
consensus TCAGCTTCATGCAGATAGGGTTTCTTAGCTTCTTCCGATCCGCAGGTCAGGTTTGGTTTT
 
. : . : . : . : . : . :
JMSF030M11+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTCTTCAATTC
JMFS105B06+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACT
JMSF049H10+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTT
JMFS082H03+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTC
JMSF003N17+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTC
JMSF036P18+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTCTTCAATTCGCTCTTCTC
JMFS125C06+ TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTCTTCAATTCGCTCTTCTCACAGC
                      ____________________________________________________________
consensus TGTGTGTTAGAAGAGTTGGCTATGCATTTCTTCACTTCTTCAATTCGCTCTTCTCACAGC
 
. : . : . : . : . : . :
JMFS125C06+ ATCACATGTTGATGCTGTTAACTACTATCCACCAACCAACCACCTTCATTTTCATTTCAT
                      ____________________________________________________________
consensus ATCACATGTTGATGCTGTTAACTACTATCCACCAACCAACCACCTTCATTTTCATTTCAT
 
. : . : . : . : . : . :
JMFS125C06+ TAACCCACCATCCAAGTTTCAGCTCATTAACACTCCATCCTACTCATCATAAACCCAACT
                      ____________________________________________________________
consensus TAACCCACCATCCAAGTTTCAGCTCATTAACACTCCATCCTACTCATCATAAACCCAACT
 
. : . : . : . : . : . :
JMFS125C06+ AAATACATTTATTTTCCTCAAAAAACAACCAACTAAACACCACCAAGCAACAAACCTAGA
                      ____________________________________________________________
consensus AAATACATTTATTTTCCTCAAAAAACAACCAACTAAACACCACCAAGCAACAAACCTAGA
 
. : . : . : . : . : . :
JMFS125C06+ CTATTAACTTATTAGCTTACGTTAATCAACTACTTAAACTATATATGAGTGTTAAATTAA
                      ____________________________________________________________
consensus CTATTAACTTATTAGCTTACGTTAATCAACTACTTAAACTATATATGAGTGTTAAATTAA