Previous Contig 003893:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS061E05Sequence642003893 (4)gb:AY661462_16204121e-27Arabidopsis thaliana chloroplast polyprotein of elongation factor Ts precursor,
JMFS079G07Sequence622003893 (4)gb:AY661462_16204128e-24Arabidopsis thaliana chloroplast polyprotein of elongation factor Ts precursor,
JMFS125B08Sequence571003893 (4)gb:AY661462_16204128e-10Arabidopsis thaliana chloroplast polyprotein of elongation factor Ts precursor,
JMFS143A11Sequence619003893 (4)gb:AY661462_16204122e-55Arabidopsis thaliana chloroplast polyprotein of elongation factor Ts precursor,

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS143A11+ AGCCCCCCATGATCTC
                      ____________________________________________________________
consensus AGCCCCCCATGATCTC
 
. : . : . : . : . : . :
JMFS143A11+ GCCAAGCCCTTCATCAGCCATCTCCGATGTTGGCAGGAACCCCTCTTCCCCTTCAGGAAG
                      ____________________________________________________________
consensus GCCAAGCCCTTCATCAGCCATCTCCGATGTTGGCAGGAACCCCTCTTCCCCTTCAGGAAG
 
. : . : . : . : . : . :
JMFS143A11+ TGATATGAAAGCACCAGACCTGGTTAAATTCTTTACTGTTCCTTCAAGATCCTGCCCCTT
                      ____________________________________________________________
consensus TGATATGAAAGCACCAGACCTGGTTAAATTCTTTACTGTTCCTTCAAGATCCTGCCCCTT
 
. : . : . : . : . : . :
JMFS143A11+ CACAAACTTCGACTCTCTTCTTTGGTTGTTCCTTTGAGGGGTTCTCTTTGGTGCTCTAGA
                      ____________________________________________________________
consensus CACAAACTTCGACTCTCTTCTTTGGTTGTTCCTTTGAGGGGTTCTCTTTGGTGCTCTAGA
 
. : . : . : . : . : . :
JMFS143A11+ TTTATCACTGCTGCCAGGAGAATCTTTTGGCTGCTTTTCCCTACTCGTTTCATCACTTTC
                      ____________________________________________________________
consensus TTTATCACTGCTGCCAGGAGAATCTTTTGGCTGCTTTTCCCTACTCGTTTCATCACTTTC
 
. : . : . : . : . : . :
JMFS143A11+ ACGCATAGTCAGTGATATCCGTCCTGTCTCCATATTCGCTTCAAGTAACCTCACCGTTAC
                      ____________________________________________________________
consensus ACGCATAGTCAGTGATATCCGTCCTGTCTCCATATTCGCTTCAAGTAACCTCACCGTTAC
 
. : . : . : . : . : . :
JMFS143A11+ CTCTTGTCCAACAGAAACAACGCTAGTAACATCCTTCACAAAACTGTTACTCAAATTAGA
JMFS061E05+ TCAAATTAGA
                      ____________________________________________________________
consensus CTCTTGTCCAACAGAAACAACGCTAGTAACATCCTTCACAAAACTGTTACTCAAATTAGA
 
. : . : . : . : . : . :
JMFS143A11+ AACATGAACAAGCCCATCTGTGAAAGCCCCGAAATCAACAAAAGCTCCAAATGGCTGGAT
JMFS061E05+ AACATGAACAAGCCCATCTGTGAAAGCNCCGAAATCAACAAAAGCTCCAAATGGCTGGAT
JMFS079G07+ GCCCATCTGTGAAAGCNCCGAAATCAACAAAAGCTCCAAATGGCTGGAT
                      ____________________________________________________________
consensus AACATGAACAAGCCCATCTGTGAAAGCCCCGAAATCAACAAAAGCTCCAAATGGCTGGAT
 
. : . : . : . : . : . :
JMFS143A11+ TGATTTGACCTTTCCCGTGAAACTTGCACCGGGAATCAGATCTTCATTCTTTATAGGAGG
JMFS061E05+ TGATTTGACCTTTCCCGTGAAACTTGCACCGGGAATCAGATCTTCATTCTTTATAGGAGG
JMFS079G07+ TGATTTGACCTTTCCCGTGAAACTTGCACCGGGAATCAGATCTTCATTCTTTATAGGAGG
JMFS125B08+ CGGGAATCAGATCTTCATTCTTTATAGGAGG
                      ____________________________________________________________
consensus TGATTTGACCTTTCCCGTGAAACTTGCACCGGGAATCAGATCTTCATTCTTTATAGGAGG
 
. : . : . : . : . : . :
JMFS143A11+ CATCTCACTCTTCCTAGCAGGCCTTGAACGTCTCGATGGAGCAGGGGTAGGACTGGCATC
JMFS061E05+ CATCTCACTCTTCCTAGCAGGCCTTGAACGTCTCGATGGAGCAGGGGTAGGACTGGCATC
JMFS079G07+ CATCTCACTCTTCCTAGCAGGCCTTGAACGTCTCGATGGAGCAGGGGTAGGACTGGCATC
JMFS125B08+ CATCTCACTCTTCCTAGCAGGCCTTGAACGTCTCGATGGAGCAGGGGTAGGACTGGCATC
                      ____________________________________________________________
consensus CATCTCACTCTTCCTAGCAGGCCTTGAACGTCTCGATGGAGCAGGGGTAGGACTGGCATC
 
. : . : . : . : . : . :
JMFS143A11+ TGACTCGACAGGTGAATTTTCTGGTGCCCCCGAAGGACTCTTATCTACAGTGGCCGAGTC
JMFS061E05+ TGACTCGACAGGTGAATTTTCTGGTGCCCCCGAAGGACTCTTATCTACAGTGGCCGAGTC
JMFS079G07+ TGACTCGACAGGTGAATTTTCTGGTGCCCCCGAAGGACTCTTATCTACAGTGGCCGAGTC
JMFS125B08+ TGACTCGACAGGTGAATTTTCTGGTGCCCCCGAAGGACTCTTATCTACAGTGGCCGAGTC
                      ____________________________________________________________
consensus TGACTCGACAGGTGAATTTTCTGGTGCCCCCGAAGGACTCTTATCTACAGTGGCCGAGTC
 
. : . : . : . : . : . :
JMFS143A11+ TGC
JMFS061E05+ TGCCTCTTCTACTGCTACATCAGTCTCAGCTGACGACACTATGGGGGTTCTTAATTTAGG
JMFS079G07+ TGCCTCTTCTACTGCTACATCAGTCTCAGCTGACGACACTATGGGGGTTCTTAATTTAGG
JMFS125B08+ TGCCTCTTCTACTGCTACATCAGTCTCAGCTGACGACACTATGGGGGTTCTTAATTTAGG
                      ____________________________________________________________
consensus TGCCTCTTCTACTGCTACATCAGTCTCAGCTGACGACACTATGGGGGTTCTTAATTTAGG
 
. : . : . : . : . : . :
JMFS061E05+ CTGTATATCAAAGCCAACTCTCAAGTGGGGAAACAATCTAACGGGTGTCGAAAATGGTAT
JMFS079G07+ CTGTATATCAAGGCCAACTCTCAAGTGGGGAAACAATCTAACGGGTGTCGAAAATGGTAT
JMFS125B08+ CTGTATATCAAAGCCAACTCTCAAGTGGGGAAACAATCTAACGGGTGTCGAAAATGGTAT
                      ____________________________________________________________
consensus CTGTATATCAAAGCCAACTCTCAAGTGGGGAAACAATCTAACGGGTGTCGAAAATGGTAT
 
. : . : . : . : . : . :
JMFS061E05+ GGCATATCTTTGGGCAGATAATGTTTGTCTGCCAGGTTTCTGAAAAACGCTGCACCTTGT
JMFS079G07+ GGCATATCTTTGGGCAGATAATGTTTGTCTGCCAGGTTTCTGAAAAACGCTGCACCTTGT
JMFS125B08+ GGCATATCTTTGGGCAGATAATGTTTGTCTGCCAGGTTTCTGAAAAACGCTGCACCTTGT
                      ____________________________________________________________
consensus GGCATATCTTTGGGCAGATAATGTTTGTCTGCCAGGTTTCTGAAAAACGCTGCACCTTGT
 
. : . : . : . : . : . :
JMFS061E05+ TAAAAGATTGTTCTTTCTGCTAATGAGGATATTGCACGGAGTTAGTGAAATACTGTTAAC
JMFS079G07+ TAAAAGATTGTTCTTTCTGCTAATGAGGATATTGCACGGAGTTAGTGAAATACTGTTAAC
JMFS125B08+ TAAAAGATTGTTCTTTCTGCTAATGAGGATATTGCACGGAGTTAGTGAAATACTGTTAAC
                      ____________________________________________________________
consensus TAAAAGATTGTTCTTTCTGCTAATGAGGATATTGCACGGAGTTAGTGAAATACTGTTAAC
 
. : . : . : . : . : . :
JMFS061E05+ CGTAGTGGGAATCACAGGAGCCATGCCGAATGAATATGTGAAATAGGGTACCAAGCACGA
JMFS079G07+ CGTAGTGGGAATCACAGGAGCCATGCCGAATGAATATGTGAAATAGGGTACCAAGCACGA
JMFS125B08+ CGTAGTGGGAATCACAGGAGCCATGCCGAATGAATATGTGAAATAGGGTACCAAGCACGA
                      ____________________________________________________________
consensus CGTAGTGGGAATCACAGGAGCCATGCCGAATGAATATGTGAAATAGGGTACCAAGCACGA
 
. : . : . : . : . : . :
JMFS061E05+ GCTATACGAGTTTTTGCATTATTCCCTCACCAGAAACTATGCAATTGAAGAAAATTGTGG
JMFS079G07+ GCTATACGAGTTTTTGCATTATTCCCTCACCAGAAACTATGCAATTGAAGAAAATTGTGG
JMFS125B08+ GCTATACGAGTTTTTGCATTATTCCCTCACCAGAAACTATGCAATTGAAGAAAATTGTGG
                      ____________________________________________________________
consensus GCTATACGAGTTTTTGCATTATTCCCTCACCAGAAACTATGCAATTGAAGAAAATTGTGG
 
. : . : . : . : . : . :
JMFS061E05+ GGTTCCGAGGAAAACCCAGGCTTATGTGTTTG
JMFS079G07+ GGTTCCGAGGAAAACCCAGGCTTATGTGTTTG
JMFS125B08+ GGTTCCGAGGAAAACCCAGGCTTATGTGTTTGTGTCACCGCTTAGCAGAGGTCTATGTTT
                      ____________________________________________________________
consensus GGTTCCGAGGAAAACCCAGGCTTATGTGTTTGTGTCACCGCTTAGCAGAGGTCTATGTTT