Previous Contig 003889:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033M06Sequence574003889 (3)gb:AY057556_15639732e-66Arabidopsis thaliana At1g27840/F28L5_15 mRNA, complete cds.>gb:AY074265_1567427 652009778 (2)gb:AP005476_18525602e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFS124G01Sequence582003889 (3)gb:AK175747_18177354e-12Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-29-M18.>gb:AK175917_18179
JMSF009O12Sequence213003889 (3)381009778 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033M06+ ACATCTTCAGTTCCAG
                      ____________________________________________________________
consensus ACATCTTCAGTTCCAG
 
. : . : . : . : . : . :
JMFF033M06+ CAGCAATTAGCATATGAGATGTTGCCAGAGAAGACATGGCAGTCTTATTAACCTTTCCAG
                      ____________________________________________________________
consensus CAGCAATTAGCATATGAGATGTTGCCAGAGAAGACATGGCAGTCTTATTAACCTTTCCAG
 
. : . : . : . : . : . :
JMFF033M06+ GCATTTTAAAATTAACAACCACCTGTGTTGTGTTTGTGTCCCATACATTAACGCGATGGT
                      ____________________________________________________________
consensus GCATTTTAAAATTAACAACCACCTGTGTTGTGTTTGTGTCCCATACATTAACGCGATGGT
 
. : . : . : . : . : . :
JMFF033M06+ CATATGAACCAGTGACAAACAGGCCAGTGTCAACTGGATACCATATGGCTGTAGAAACGG
                      ____________________________________________________________
consensus CATATGAACCAGTGACAAACAGGCCAGTGTCAACTGGATACCATATGGCTGTAGAAACGG
 
. : . : . : . : . : . :
JMFF033M06+ CATATTTGTGGCCCTGTTCATGTCGTTTGTCAACAACAAAAAGGGGCTTATGCTTAGCGA
                      ____________________________________________________________
consensus CATATTTGTGGCCCTGTTCATGTCGTTTGTCAACAACAAAAAGGGGCTTATGCTTAGCGA
 
. : . : . : . : . : . :
JMFF033M06+ TCAATCCACCTCCCTCATGACCTGTTGCACGTTGGACATCATAAACAGCAACTGATGCAT
                      ____________________________________________________________
consensus TCAATCCACCTCCCTCATGACCTGTTGCACGTTGGACATCATAAACAGCAACTGATGCAT
 
. : . : . : . : . : . :
JMFF033M06+ CCGAAGCACAGGATAGTAAATACCTTTGCTCTGTCAAATCAACCTGAAGAGAGTTAACGG
JMFS124G01+ AACCTGAAGAGAGTTAACGG
                      ____________________________________________________________
consensus CCGAAGCACAGGATAGTAAATACCTTTGCTCTGTCAAATCAACCTGAAGAGAGTTAACGG
 
. : . : . : . : . : . :
JMFF033M06+ GGCCGCGGTGAGGGGAGACGATCTCTTTGTGATTGGAGAGCTGAATAGCAGCAAGTCGGT
JMFS124G01+ GGCCGCGGTGAGGGGAGACGATCTCTTTGTGATTGGAGAGCTGAATAGCAGCGAGTCGGT
                      ____________________________________________________________
consensus GGCCGCGGTGAGGGGAGACGATCTCTTTGTGATTGGAGAGCTGAATAGCAGCGAGTCGGT
 
. : . : . : . : . : . :
JMFF033M06+ TCAACTTAACTCGGTTGCTGTACGAATTAGGTCGAAGTTTCCCTGATTCTCTGTCCCTGA
JMFS124G01+ TCAACTTAACTCGGTTGCTGTACGAATTAGGTCGAAGTTTCCCTGATTCTCTGTCCCTGA
                      ____________________________________________________________
consensus TCAACTTAACTCGGTTGCTGTACGAATTAGGTCGAAGTTTCCCTGATTCTCTGTCCCTGA
 
. : . : . : . : . : . :
JMFF033M06+ TTTCCTTCCACATCTTCTTCCTCGCATCCTTCCCGGCTTCCACCAACTGCTTAGATCCAC
JMSF009O12+ TTCCACATCTTCTTCCTCGCATCCTTCCCGGCTTCCACCAACTGCTTAGATCCAC
JMFS124G01+ TTTCCTTCCACATCTTCTTCCTCGCATCCTTCCCGGCTTCCACCAACTGCTTAGATCCAC
                      ____________________________________________________________
consensus TTTCCTTCCACATCTTCTTCCTCGCATCCTTCCCGGCTTCCACCAACTGCTTAGATCCAC
 
. : . : . : . : . : . :
JMFF033M06+ CGCCACAACCGACCAGCC
JMSF009O12+ CGCCACAACCGACCAGCCGGATTCAATTCCCCCCAGCTTCTCTGTATGTATAAGTATAAG
JMFS124G01+ CGCCACAACCGACCAGCCGGATTCAATTCCCCCCAGCTTCTCTGTATGTATAAGTATAAG
                      ____________________________________________________________
consensus CGCCACAACCGACCAGCCGGATTCAATTCCCCCCAGCTTCTCTGTATGTATAAGTATAAG
 
. : . : . : . : . : . :
JMSF009O12+ TTTTACACCCAACACACAACATATATTGATCTCAATCGCACAGAAATATGCATAAGAAAT
JMFS124G01+ TTTTACACCCAACACACAACATATATTGATCTCAATCGCACAGAAATATGCATAAGAAAT
                      ____________________________________________________________
consensus TTTTACACCCAACACACAACATATATTGATCTCAATCGCACAGAAATATGCATAAGAAAT
 
. : . : . : . : . : . :
JMSF009O12+ CACAATCGCAAATCTTTTCTCTTCTGCTTTGCCGT
JMFS124G01+ CACAATCGCAAATCTTTTCTCTTCTGCTTTGCCGTCACTGGACTATTTCTCACATTTCAC
                      ____________________________________________________________
consensus CACAATCGCAAATCTTTTCTCTTCTGCTTTGCCGTCACTGGACTATTTCTCACATTTCAC