Previous Contig 003887:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012H17Sequence548003887 (9)752013792 (4)
JMFS007A09Sequence621003887 (9)gb:AF139835_17714524e-07Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,
JMFS009D10Sequence579003887 (9)gb:AF139835_17714520.007Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,
JMFS072D07Sequence642003887 (9)gb:AF139835_17714522e-21Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,
JMFS119C05Sequence624003887 (9)gb:AF139835_17714527e-10Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,
JMFS124C03Sequence565003887 (9)
JMFS143A03Sequence624003887 (9)gb:AF139835_17714521e-11Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,
JMSF008C24Sequence392003887 (9)778013792 (4)gb:AY091772_15747320.048Arabidopsis thaliana AT4g24390/T22A6_220 mRNA, complete cds.>gb:BT006340_1639227
JMSF020B11Sequence691003887 (9)gb:AF139835_17714523e-17Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,798013792 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072D07+ GCGCTTGGGCGACACGGCGTAGCAGTTGCCGATGAACACCTCGGATCTGGTCAT
JMFS143A03+ GTCAT
JMSF020B11+ GTAGCAGTTGCCGATGAACACCTCGGATCTGGTCAT
                      ____________________________________________________________
consensus GCGCTTGGGCGACACGGCGTAGCAGTTGCCGATGAACACCTCGGATCTGGTCAT
 
. : . : . : . : . : . :
JMFS072D07+ GGCCTCCGCCCGGTACCAGGACTTGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
JMFS119C05+ CGGTACCAGGACTTGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
JMFS009D10+ GGTCGCGGCGATC
JMFS007A09+ TGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
JMFS143A03+ GGCCTCCGCCCGGTACCAGGACTTGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
JMSF020B11+ GGCNTCCGCCCGGTACCAGGACTTGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
                      ____________________________________________________________
consensus GGCCTCCGCCCGGTACCAGGACTTGCATACCAGCGACGCGCTGTTCCGGTCGCGGCGATC
 
. : . : . : . : . : . :
JMFS072D07+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMFS119C05+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMFS009D10+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMFS007A09+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMFS143A03+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMSF020B11+ GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
JMFF012H17+ GAGTACGACGG
JMFS124C03+ CCAACACCTGATCTGAGTACGACGG
                      ____________________________________________________________
consensus GCTGAGGAAGCACAGCACGTTCTCCAGCACATTCTCCAACACCTGATCTGAGTACGACGG
 
. : . : . : . : . : . :
JMFS072D07+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFS119C05+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFS009D10+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFS007A09+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFS143A03+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMSF020B11+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFF012H17+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
JMFS124C03+ AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
                      ____________________________________________________________
consensus AACGAAGCAGTGATCTCCTCCCCCGCCAATCGAGCAGATGCGGGGTTTAGCCGCACCGCC
 
. : . : . : . : . : . :
JMFS072D07+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFS119C05+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFS009D10+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFS007A09+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFS143A03+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMSF020B11+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFF012H17+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
JMFS124C03+ ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
                      ____________________________________________________________
consensus ACCGCCGAGATCTGAAGCAGACGACGACGGCCGCGACGGCTCCTCGTCTTCGGACATTTC
 
. : . : . : . : . : . :
JMFS072D07+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMFS119C05+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMFS009D10+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMFS007A09+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMFS143A03+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMSF020B11+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMFF012H17+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
JMSF008C24+ CGAATTACTAGTCATGTGACTCATCACACGCCC
JMFS124C03+ TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
                      ____________________________________________________________
consensus TGACCGCTCCTCGCTACTACTCGGACTCGAATTACTAGTCATGTGACTCATCACACGCCC
 
. : . : . : . : . : . :
JMFS072D07+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFS119C05+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFS009D10+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFS007A09+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFS143A03+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMSF020B11+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFF012H17+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMSF008C24+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
JMFS124C03+ GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
                      ____________________________________________________________
consensus GCCCCCCGGCCTCTCTTCAGATTTATCAACTGGATTCCTCTCAACTCTGTCTCAAATCTA
 
. : . : . : . : . : . :
JMFS072D07+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFS119C05+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFS009D10+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFS007A09+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFS143A03+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMSF020B11+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFF012H17+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMSF008C24+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
JMFS124C03+ TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
                      ____________________________________________________________
consensus TACCAATAATATATATTATTATAATAATTAAAAAAAGAATATCGCCCAGACAGCAATCAA
 
. : . : . : . : . : . :
JMFS072D07+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFS119C05+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFS009D10+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFS007A09+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFS143A03+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMSF020B11+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFF012H17+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMSF008C24+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
JMFS124C03+ TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
                      ____________________________________________________________
consensus TTTTTTAAAATATTTTTCAGATCATGGAAGAGTTGAGTTGAGGAAGGTGAAGGGCTCTTT
 
. : . : . : . : . : . :
JMFS072D07+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFS119C05+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFS009D10+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFS007A09+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFS143A03+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMSF020B11+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFF012H17+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMSF008C24+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
JMFS124C03+ GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
                      ____________________________________________________________
consensus GGCTTATAGCAAACCCTGCCGCCTGTGGACTATATCCACTCTTTTTCCTCTCCTTCTTCC
 
. : . : . : . : . : . :
JMFS072D07+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGG
JMFS119C05+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMFS009D10+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMFS007A09+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMFS143A03+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMSF020B11+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMFF012H17+ GCTTCAACTA-ATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMSF008C24+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
JMFS124C03+ GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
                      ____________________________________________________________
consensus GCTTCAACTACATATAAGCCTGCGATAGGAGGCGGAGGAGCACGGCGGAGAGCGGCGGCG
 
. : . : . : . : . : . :
JMFS119C05+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGT
JMFS009D10+ GAGGAGGGAGCAAGCATTGGGATTTC
JMFS007A09+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTC
JMFS143A03+ GAGGAGGGAGCAAGCATTG
JMSF020B11+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTCTCCAAAG
JMFF012H17+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTCTCCAAAG
JMSF008C24+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTCTCCAAAG
JMFS124C03+ GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTCTCCAAAGTCCAATTGC
                      ____________________________________________________________
consensus GAGGAGGGAGCAAGCATTGGGATTTCTCCATGGTTATAAGCCTCTCCAAAGTCCAATTGC