Previous Contig 003884:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F13Sequence453003884 (16)gb:AB124880_15280993e-27Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.745013906 (4)gb:AB124880_15280993e-96Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFF028B19Sequence549003884 (16)gb:AB124880_15280993e-33Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.595013906 (4)gb:AB124880_15280993e-67Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS015F09Sequence535003884 (16)gb:AB124880_15280996e-85Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS063E03Sequence618003884 (16)gb:AB124880_15280996e-43Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS063F09Sequence637003884 (16)gb:AB124880_15280991e-54Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS082E01Sequence618003884 (16)gb:AB124880_15280994e-53Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS106D05Sequence642003884 (16)gb:AB124880_15280998e-57Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS116C03Sequence597003884 (16)gb:AB124880_15280994e-52Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS123H06Sequence574003884 (16)gb:AB124880_15280992e-34Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS124A05Sequence319003884 (16)gb:AB124880_15280994e-13Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS141H11Sequence638003884 (16)gb:AB124880_1528099e-104Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS154C09Sequence626003884 (16)gb:AB124880_15280996e-60Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS155C01Sequence636003884 (16)gb:AB124880_15280996e-60Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS155D02Sequence516003884 (16)gb:AB124880_15280993e-12Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMSF034H06Sequence652003884 (16)gb:AB124880_15280993e-60Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.702013906 (4)gb:AB124879_1528098e-106Nicotiana tabacum mRNA for ubiquitin activating enzyme 1, complete cds.
JMSF050N12Sequence687003884 (16)gb:AB124880_15280991e-59Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.801013906 (4)gb:AB124880_1528099e-104Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS141H11+ AGAAGTCAC
                      ____________________________________________________________
consensus AGAAGTCAC
 
. : . : . : . : . : . :
JMFS141H11+ TGAGAAGANAATCACCAGGATCCTTAAGTGTTTCTCGCAGCGGCTTGAATTTCAAGACTT
                      ____________________________________________________________
consensus TGAGAAGANAATCACCAGGATCCTTAAGTGTTTCTCGCAGCGGCTTGAATTTCAAGACTT
 
. : . : . : . : . : . :
JMFS141H11+ TAGGTTCCTTTACCTGTGTGACAATACCACCTCCCTCATATGCGGTATACTTTGTGGTAT
                      ____________________________________________________________
consensus TAGGTTCCTTTACCTGTGTGACAATACCACCTCCCTCATATGCGGTATACTTTGTGGTAT
 
. : . : . : . : . : . :
JMFS141H11+ CTTCTTCAATCGTAAATGAATAAGGCCTTGCATTTTTTATTTTCCTTGGCTTTCCATCAT
                      ____________________________________________________________
consensus CTTCTTCAATCGTAAATGAATAAGGCCTTGCATTTTTTATTTTCCTTGGCTTTCCATCAT
 
. : . : . : . : . : . :
JMFS141H11+ TCAATTCTGTCATTCCTCGGACTTCGGAAAAGACAATAAGATCTCCATCCTGAAACTCAA
                      ____________________________________________________________
consensus TCAATTCTGTCATTCCTCGGACTTCGGAAAAGACAATAAGATCTCCATCCTGAAACTCAA
 
. : . : . : . : . : . :
JMFS141H11+ GCCTTTCATCATCAACGCACGCAACAAGAGCAGGATTGTCATTGCTAATAGATGCAATAA
                      ____________________________________________________________
consensus GCCTTTCATCATCAACGCACGCAACAAGAGCAGGATTGTCATTGCTAATAGATGCAATAA
 
. : . : . : . : . : . :
JMFS141H11+ TGCCTGTACGTGGATCCTCGCCATCAACATCAAGAACTGTGAATTCAGGGCCAAAGTCAC
JMFS015F09+ GATCCTCGCCATCAACATCAAGAACTGTGAATTCAGGGCCAAAGTCAC
                      ____________________________________________________________
consensus TGCCTGTACGTGGATCCTCGCCATCAACATCAAGAACTGTGAATTCAGGGCCAAAGTCAC
 
. : . : . : . : . : . :
JMFS141H11+ AAAATACACTACCAAAAAGGCCACATACTTCAGTTTTGATAAAGGCAATTGGAGGCTGGT
JMFS015F09+ AAAATACACTACCAAAAAGGCCACATACTTCAGTTTTGATAAAGGCAATTGGAGGCTGGT
                      ____________________________________________________________
consensus AAAATACACTACCAAAAAGGCCACATACTTCAGTTTTGATAAAGGCAATTGGAGGCTGGT
 
. : . : . : . : . : . :
JMFS141H11+ GATTATGACAGTAATCATCAAATTCCATTGCCTTCTCTAAGCGGATATCAGTAAATACAG
JMFS015F09+ GATTATGACAGTAATCATCAAATTCCATTGCCTTCTCTAAGCGGATATCAGTAAATACAG
JMFS154C09+ CGGATATCAGTAAATACAG
JMFS155C01+ AGCGGATATCAGTAAATACAG
JMSF034H06+ AGCGGATATCAGTAAATACAG
JMSF050N12+ AGCGGATATCAGTAAATACAG
                      ____________________________________________________________
consensus GATTATGACAGTAATCATCAAATTCCATTGCCTTCTCTAAGCGGATATCAGTAAATACAG
 
. : . : . : . : . : . :
JMFS141H11+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMFS015F09+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMFS154C09+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMFS155C01+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMSF034H06+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMFS106D05+ TGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATNTGTTAGGGTAGAAATAATCA
JMFS082E01+ TCCTTACTCAACTCATTTGTTAGGGTAGAAATAATGA
JMFS116C03+ CTCATTTGTTAGGGTAGAAATAATCA
JMFS063F09+ AGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
JMSF050N12+ CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCANTTGTTAGGGTAGAAATAATCA
                      ____________________________________________________________
consensus CTGCCTGAAAATCAGAGAGTTGTTCCTTACTCAACTCATTTGTTAGGGTAGAAATAATCA
 
. : . : . : . : . : . :
JMFS141H11+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS015F09+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS154C09+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS155C01+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMSF034H06+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS106D05+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS082E01+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS116C03+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS063F09+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMSF050N12+ CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
JMFS063E03+ AAGCAAGAGCCCTGTTTTTCCCCACAT
                      ____________________________________________________________
consensus CAGAATTGTTTAGTTCTTGCAATTTCTGAACAGAAGCAAGAGCCCTGTTTTTCCCCACAT
 
. : . : . : . : . : . :
JMFS141H11+ CATCCTCAGAGAAAACAAAATTGCTAGAC
JMFS015F09+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS154C09+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS155C01+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMSF034H06+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS106D05+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS082E01+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS116C03+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS063F09+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMSF050N12+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFF009F13+ GT
JMFS155D02+ CAGCTGCACATTTCCTTCATGGT
JMFF028B19+ ATCCCACAGCTCCACATTTCCTTCATCGT
JMFS063E03+ CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
JMFS123H06+ GCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
                      ____________________________________________________________
consensus CATCCTCAGAGAAAACAAAATTGCTAGACAGATCCCACAGCTCCACATTTCCTTCATCGT
 
. : . : . : . : . : . :
JMFS015F09+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS154C09+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS155C01+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMSF034H06+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS106D05+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS082E01+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS116C03+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS063F09+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMSF050N12+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFF009F13+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS155D02+ GTAAAGGAACAGATTTGGCCGCAGCAAGAATGAGGTTGTTCGCGATGTGAACTATGAGGC
JMFF028B19+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS063E03+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
JMFS123H06+ GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
                      ____________________________________________________________
consensus GTAAAGTAACAGATTTGACACCAGCAAGAATGAGGTTCTTCGCGATCTCAACTCCGAGGC
 
. : . : . : . : . : . :
JMFS015F09+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS154C09+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS155C01+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMSF034H06+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS106D05+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS082E01+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS116C03+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS063F09+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMSF050N12+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS124A05+ AACATTAGA-GCCGATCAACCGA-CGCATGGTCT-CACGGC
JMFF009F13+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS155D02+ CTTTCATTCGAGGGATAAGAACATTAGATGGGGAGCAACCGAGGGCATGGTATGCACGGC
JMFF028B19+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS063E03+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
JMFS123H06+ CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
                      ____________________________________________________________
consensus CTTTCATTCCAGAGATAAGAACATTAGA-GCCGAACAACCGA-CGCATGGTCT-CACGGC
 
. : . : . : . : . : . :
JMFS015F09+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS154C09+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS155C01+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMSF034H06+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS106D05+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS082E01+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS116C03+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS063F09+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMSF050N12+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS124A05+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFF009F13+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS155D02+ CGATACACAGCGAGCTGAGGAGTGTGCAGATCGTCATCGATGTTGGGAGGATTACACGAG
JMFF028B19+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS063E03+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
JMFS123H06+ C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
                      ____________________________________________________________
consensus C-ATACACAGCGAGCTGACGGCTGTGCAGATCCTCATCGATGTCGGGAGAATTACGCGAG
 
. : . : . : . : . : . :
JMFS015F09+ CAGTCAATCGG
JMFS154C09+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS155C01+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMSF034H06+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS106D05+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS082E01+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS116C03+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS063F09+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMSF050N12+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS124A05+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFF009F13+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS155D02+ CAGTCAGTCGGCGATTTGCCATTGTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFF028B19+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS063E03+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
JMFS123H06+ CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
                      ____________________________________________________________
consensus CAGTCAATCGGCGATTTACCATTCTCAGTCCGACGGCCGTTACTAACAGCATCATTTCCG
 
. : . : . : . : . : . :
JMFS154C09+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS155C01+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMSF034H06+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS106D05+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS082E01+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS116C03+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS063F09+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMSF050N12+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS124A05+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFF009F13+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS155D02+ TTCACCTGCAAGCCTTCCATGTCGACGCTGGATTCCTATGCGCGGCGGCCGATATAGCAG
JMFF028B19+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS063E03+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
JMFS123H06+ TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
                      ____________________________________________________________
consensus TTCACCTCCACGCCTCCCATCTCGACACTCGATTCCTCTCCGCCGCCGCCGATATAGCAA
 
. : . : . : . : . : . :
JMFS154C09+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS155C01+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMSF034H06+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS106D05+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS082E01+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS116C03+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS063F09+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMSF050N12+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS124A05+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFF009F13+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS155D02+ TCGGATTTAAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACGTTTTAGTTGT
JMFF028B19+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS063E03+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
JMFS123H06+ TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
                      ____________________________________________________________
consensus TCGGATTTGAGCCGTTTGTTCAGGGAATAAGAAGCAGAGGAAGAAGAACCTTCTAGTTCT
 
. : . : . : . : . : . :
JMFS154C09+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTC
JMFS155C01+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMSF034H06+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGT-----
JMFS106D05+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS082E01+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS116C03+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS063F09+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMSF050N12+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS124A05+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGA
JMFF009F13+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS155D02+ GAAG
JMFF028B19+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS063E03+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
JMFS123H06+ GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
                      ____________________________________________________________
consensus GAAGCGGCGGCGTCCCCTCCAACTGCTGACCTCTTCAACGGAAGCATAAAGCGGTCTGAA
 
. : . : . : . : . : . :
JMFS155C01+ CGAAAAAGACAATGAAGGA
JMSF034H06+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAG
JMFS106D05+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGG
JMFS082E01+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGT
JMFS116C03+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAG
JMFS063F09+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTG
JMSF050N12+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTGAGAT
JMFF009F13+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAG
JMFF028B19+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTGAGAT
JMFS063E03+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTGAGAT
JMFS123H06+ CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTGAGAT
                      ____________________________________________________________
consensus CGAAAAAGACAATGAAGGACTGAAGGAAGCTCAAGGAAGGAAAGTGGGGATGCCTGAGAT
 
. : . : . : . : . : . :
JMSF050N12+ TATTAATAG
JMFF028B19+ TATTAATAGGGTTTCCTTCATCACCTTTCGGAGCTTATTAATCA
JMFS063E03+ TATTAATAGGGTTTCCTTCATCACCTTTCGGAGCTTATTAATCAAGGAAATGAGA
JMFS123H06+ TATTAATAGGGTTTCCTTCATCACCTTTCGGAGCTTATTAATCAAGGAAATGAGAGTGTT
                      ____________________________________________________________
consensus TATTAATAGGGTTTCCTTCATCACCTTTCGGAGCTTATTAATCAAGGAAATGAGAGTGTT