Previous Contig 003882:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS123E02Sequence575003882 (4)gb:AE005173_8951012e-25Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153
JMFS124C08Sequence566003882 (4)gb:AE005173_8951012e-24Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153
JMFS132B10Sequence625003882 (4)gb:AE005173_8951011e-30Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153
JMSF029J21Sequence641003882 (4)pir|T04587|T045874e-38hypothetical protein F23E13.70 - Arabidopsis thaliana>gb:ATCHRIV84_1547578 Arabi489023399gb:AY080606_15683507e-28Arabidopsis thaliana putative receptor protein kinase (At4g36180) mRNA, partial

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029J21+ CCGGAGAACGAGTTGGAGGAGAGATCCAGGAACC
                      ____________________________________________________________
consensus CCGGAGAACGAGTTGGAGGAGAGATCCAGGAACC
 
. : . : . : . : . : . :
JMSF029J21+ GGAGGNTGCGAGGAACACCGCCGGGGATTCCACCGGACATAAAGTTCCGAGCGACGTTGA
JMFS132B10+ GACATAAAGTTCCGAGCGACGTTGA
                      ____________________________________________________________
consensus GGAGGNTGCGAGGAACACCGCCGGGGATTCCACCGGACATAAAGTTCCGAGCGACGTTGA
 
. : . : . : . : . : . :
JMSF029J21+ GAACTTGCAGATTCGTCAGGTTCGAAATCCCCGGCGGGAGGTCGCCGGAGAGCGAGTTGT
JMFS132B10+ GAACTTGCAGATTCGTCAGGTTCGAAATCCCCGGCGGGAGGTCGCCGGAGAGCGAGTTGT
JMFS124C08+ CGGGAGGTCGCCGGAGAGCGAGTTGT
JMFS123E02+ AATCCCCGGCGGGAGGTCGCCGGAGAGCGAGTTGT
                      ____________________________________________________________
consensus GAACTTGCAGATTCGTCAGGTTCGAAATCCCCGGCGGGAGGTCGCCGGAGAGCGAGTTGT
 
. : . : . : . : . : . :
JMSF029J21+ TATGCAGGTAAACCGCACGCAACAGAGAGCACCGCGACAGCCCCCGCGGCACGGAGCCGT
JMFS132B10+ TATGCAGGTAAACCGCACGCAACAGAGAGCACCGCGACAGCCCCCGCGGCACGGAGCCGT
JMFS124C08+ TATGCAGGTAAACCGCACGCAACAGAGAGCACCGCGACAGCCCCCGCGGCACGGAGCCGT
JMFS123E02+ TATGCAGGTAAACCGCACGCAACAGAGAGCACCGCGACAGCCCCCGCGGCACGGAGCCGT
                      ____________________________________________________________
consensus TATGCAGGTAAACCGCACGCAACAGAGAGCACCGCGACAGCCCCCGCGGCACGGAGCCGT
 
. : . : . : . : . : . :
JMSF029J21+ TGAGGTTGTTGGAATGCAGGCTTAACCTGCGCAGCTGGCGCAGGTTAGCAATCCGTTCAG
JMFS132B10+ TGAGGTTGTTGGAATGCAGGCTTAACCTGCGCAGCTGGCGCAGGTTAGCAATCCGTTCAG
JMFS124C08+ TGAGGTTGTTGGAATGCAGGCTTAACCTGCGCAGCTGGCGCAGGTTAGCAATCCGTTCAG
JMFS123E02+ TGAGGTTGTTGGAATGCAGGCTTAACCTGCGCAGCTGGCGCAGGTTAGCAATCCGTTCAG
                      ____________________________________________________________
consensus TGAGGTTGTTGGAATGCAGGCTTAACCTGCGCAGCTGGCGCAGGTTAGCAATCCGTTCAG
 
. : . : . : . : . : . :
JMSF029J21+ TTATCCGTCCCCGAAGCTGAAGGCGCGGCAGGCGGAGCTCAACAACGCGGCCGCCGTCAC
JMFS132B10+ TTATCCGTCCCCGAAGCTGAAGGCGCGGCAGGCGGAGCTCAACAACGCGGCCGCCGTCAC
JMFS124C08+ TTATCCGTCCCCGAAGCTGAAGGCGCGGCAGGCGGAGCTCAACAACGCGGCCGCCGTCAC
JMFS123E02+ TTATCCGTCCCCGAAGCTGAAGGCGCGGCAGGCGGAGCTCAACAACGCGGCCGCCGTCAC
                      ____________________________________________________________
consensus TTATCCGTCCCCGAAGCTGAAGGCGCGGCAGGCGGAGCTCAACAACGCGGCCGCCGTCAC
 
. : . : . : . : . : . :
JMSF029J21+ ACCGAATCCCAACCCAGTCACACGGAGCCGACGGCGTGGAAGCATCCCAGCCGTCCAATG
JMFS132B10+ ACCGAATCCCAACCCAGTCACACGGAGCCGACGGCGTGGAAGCATCCCAGCCGTCCAATG
JMFS124C08+ ACCGAATCCCAACCCAGTCACACGGAGCCGACGGCGTGGAAGCATCCCAGCCGTCCAATG
JMFS123E02+ ACCGAATCCCAACCCAGTCACACGGAGCCGACGGCGTGGAAGCATCCCAGCCGTCCAATG
                      ____________________________________________________________
consensus ACCGAATCCCAACCCAGTCACACGGAGCCGACGGCGTGGAAGCATCCCAGCCGTCCAATG
 
. : . : . : . : . : . :
JMSF029J21+ CGCCAAGCGGATCTTCCAAGTTCCCCTTGAACGACAGCAACGCCTCAACCTCCATCTCCT
JMFS132B10+ CGCCAAGCGGATCTTCCAAGTTCCCCTTGAACGACAGCAACGCCTCAACCTCCATCTCCT
JMFS124C08+ CGCCAAGCGGATCTTCCAAGTTCCCCTTGAACGACAGCAACGCCTCAACCTCCATCTCCT
JMFS123E02+ CGCCAAGCGGATCTTCCAAGTTCCCCTTGAACGACAGCAACGCCTCAACCTCCATCTCCT
                      ____________________________________________________________
consensus CGCCAAGCGGATCTTCCAAGTTCCCCTTGAACGACAGCAACGCCTCAACCTCCATCTCCT
 
. : . : . : . : . : . :
JMSF029J21+ CCGGCGTCGGCGACGCCGCAGTCGCAAAAGCAGAGGAAATTAACAACATATGCAGAAATA
JMFS132B10+ CCGGCGTCGGCGACGCCGCAGTCGCAAAAGCAGAGGAAATTAACAACATATGCAGAAATA
JMFS124C08+ CCGGCGTCGGCGACGCCGCAGTCGCAAAAGCAGAGGAAATTAACAACATATGCAGAAATA
JMFS123E02+ CCGGCGTCGGCGACGCCGCAGTCGCAAAAGCAGAGGAAATTAACAACATATGCAGAAATA
                      ____________________________________________________________
consensus CCGGCGTCGGCGACGCCGCAGTCGCAAAAGCAGAGGAAATTAACAACATATGCAGAAATA
 
. : . : . : . : . : . :
JMSF029J21+ GCGCCACCGCTGTCGCGGCGGCGGCGAAGAAGGAAAAAGTAGCCGTTGACATGAGAGCGG
JMFS132B10+ GCGCCACCGCTGTCGCGGCGGCGGCGAAGAAGGAAAAAGTAGCCGTTGACATGAGAGCGG
JMFS124C08+ GCGCCACCGCTGTCGCGGCGGCGGCGAAGAAGGAAAAAGTAGCCGTTGACATGAGAGCGG
JMFS123E02+ GCGCCACCGCTGTCGCGGCGGCGGCGAAGAAGGAAAAAGTAGCCGTTGACATGAGAGCGG
                      ____________________________________________________________
consensus GCGCCACCGCTGTCGCGGCGGCGGCGAAGAAGGAAAAAGTAGCCGTTGACATGAGAGCGG
 
. : . : . : . : . : . :
JMSF029J21+ GGGTGAAGGCTATGGGAGCGTATTGCAGACTGAGAAGGAGAAGAAAGATGACAAGATCGA
JMFS132B10+ GGGTGAAGGCTATGGGAGCGTATTGCAGACTGAGAAGGAGAAGAAAGATGACAAGATCGA
JMFS124C08+ GGGTGAAGGCTATGGGAGCGTATTGCAGACTGAGAAGGAGAAGAAAGATGACAAGATCGA
JMFS123E02+ GGGTGAAGGCTATGGGAGCGTATTGCAGACTGAGAAGGAGAAGAAAGATGACAAGATCGA
                      ____________________________________________________________
consensus GGGTGAAGGCTATGGGAGCGTATTGCAGACTGAGAAGGAGAAGAAAGATGACAAGATCGA
 
. : . : . : . : . : . :
JMSF029J21+ GGCCAT
JMFS132B10+ GGCCATGTGGCAATGGTGAAGTGCGTTTAGTTTTTGTAAGTATTGTAGGGTTCCGTTTTC
JMFS124C08+ GGCCATGTGGCAATGGTGAAGTGCGTTTAGTTTTTGTAAGTATTGTAGGGTTCCGTTTTC
JMFS123E02+ GGCCATGTGGCAATGGTGAAGTGCGTTTAGTTTTTGTAAGTATTGTAGGGTTCCGTTTTC
                      ____________________________________________________________
consensus GGCCATGTGGCAATGGTGAAGTGCGTTTAGTTTTTGTAAGTATTGTAGGGTTCCGTTTTC