Previous Contig 003879:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS123C10Sequence569003879 (2)gb:AP003371_18286321e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMFS161C09Sequence570003879 (2)gb:AP003371_18286323e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS161C09+ ACGTTT
                      ____________________________________________________________
consensus ACGTTT
 
. : . : . : . : . : . :
JMFS161C09+ AAAAGCCTTCTTTTGCTCCACTGATGGAACCATAGAATGGAGAGGAATTATTGAAAACTT
                      ____________________________________________________________
consensus AAAAGCCTTCTTTTGCTCCACTGATGGAACCATAGAATGGAGAGGAATTATTGAAAACTT
 
. : . : . : . : . : . :
JMFS161C09+ GGATGCATCTTTGAAAAATGCACTCTTATGCAATCTTTCTCTTGTTCTATTAATATCATC
                      ____________________________________________________________
consensus GGATGCATCTTTGAAAAATGCACTCTTATGCAATCTTTCTCTTGTTCTATTAATATCATC
 
. : . : . : . : . : . :
JMFS161C09+ CCACCCAGGAAGGAAAACTAGGATGGCTCCATCCTTTGAGTTCATACATATTTTTCTTAT
                      ____________________________________________________________
consensus CCACCCAGGAAGGAAAACTAGGATGGCTCCATCCTTTGAGTTCATACATATTTTTCTTAT
 
. : . : . : . : . : . :
JMFS161C09+ TAGCTGTTCAATGAGAACTTCATCAATCAATTCAGCATGAACTGTTGATAGATATTTATC
                      ____________________________________________________________
consensus TAGCTGTTCAATGAGAACTTCATCAATCAATTCAGCATGAACTGTTGATAGATATTTATC
 
. : . : . : . : . : . :
JMFS161C09+ AAGTAAAAGTTGCTGCTCCTCAGAATTGGAAAATGATTTCTCAATGTGTTTTTTAATAAT
                      ____________________________________________________________
consensus AAGTAAAAGTTGCTGCTCCTCAGAATTGGAAAATGATTTCTCAATGTGTTTTTTAATAAT
 
. : . : . : . : . : . :
JMFS161C09+ TTCAGCTGCTTCTGTCTGGTTCTGTTGTTGTGCCCAATCTAGAGCAGTTGTCCCATTCTT
JMFS123C10+ GCCCAATCTAGAGCAGTTGTCCCATTCTT
                      ____________________________________________________________
consensus TTCAGCTGCTTCTGTCTGGTTCTGTTGTTGTGCCCAATCTAGAGCAGTTGTCCCATTCTT
 
. : . : . : . : . : . :
JMFS161C09+ GGTTTTTAAGTGGCAGTCAGCACCCAGAGAAAGGAGTGTGCAAAGACCATTGATACTACC
JMFS123C10+ GGTTTTTAAGTGGCAGTCAGCACCCAGAGAAAGGAGTGTGCAAAGACCATTGATACTACC
                      ____________________________________________________________
consensus GGTTTTTAAGTGGCAGTCAGCACCCAGAGAAAGGAGTGTGCAAAGACCATTGATACTACC
 
. : . : . : . : . : . :
JMFS161C09+ TTTTCCAGCAAAAACCATCAAAGGTGTCACTCCTATCAAAGAATGTTGGTAATTAATGAC
JMFS123C10+ TTTTCCAGCAAAAACCATCAAAGGTGTCACTCCTATCAAAGAATGTTGGTAATTAATGAC
                      ____________________________________________________________
consensus TTTTCCAGCAAAAACCATCAAAGGTGTCACTCCTATCAAAGAATGTTGGTAATTAATGAC
 
. : . : . : . : . : . :
JMFS161C09+ TGCAGGTATCGCTTCAGAAGATATTATATCTAAGAGGGGATCAATCTCATCATCAGTTGC
JMFS123C10+ TGCAGGTATCGCTTCAGAAGATATTATATCTAAGAGGGGATCAATCTCATCATCAGTTGC
                      ____________________________________________________________
consensus TGCAGGTATCGCTTCAGAAGATATTATATCTAAGAGGGGATCAATCTCATCATCAGTTGC
 
. : . : . : . : . : . :
JMFS161C09+ AGCCAGATTAATAGCTTCATCTAA
JMFS123C10+ AGCCAGATTAATAGCTTCATCTAAGGCAACTCTATATTCCTCTGTTAATACGGAGTCTTT
                      ____________________________________________________________
consensus AGCCAGATTAATAGCTTCATCTAAGGCAACTCTATATTCCTCTGTTAATACGGAGTCTTT
 
. : . : . : . : . : . :
JMFS123C10+ TGAGTTGAGACTAGCTGTTGTATTGTCAAGGTGATTATTTTCCACTGATTTAACAAAACC
                      ____________________________________________________________
consensus TGAGTTGAGACTAGCTGTTGTATTGTCAAGGTGATTATTTTCCACTGATTTAACAAAACC
 
. : . : . : . : . : . :
JMFS123C10+ AAGTACATCTTCTAGGTAGAAAGTTTTTACTGGGTAAGTGAATCCAGGGACTCTGATTAT
                      ____________________________________________________________
consensus AAGTACATCTTCTAGGTAGAAAGTTTTTACTGGGTAAGTGAATCCAGGGACTCTGATTAT
 
. : . : . : . : . : . :
JMFS123C10+ TGGGCAGCCGCCAAAATACTTTGAAAAACGTTCCTCATCCATTGTGGCACTCATTAGAAT
                      ____________________________________________________________
consensus TGGGCAGCCGCCAAAATACTTTGAAAAACGTTCCTCATCCATTGTGGCACTCATTAGAAT
 
. : . : . : . : . : . :
JMFS123C10+ CAGGCGCAAATGAGGATACAAAGGAAGCATGTCCCTGATAATTGCTAGCATGAAATCGGA
                      ____________________________________________________________
consensus CAGGCGCAAATGAGGATACAAAGGAAGCATGTCCCTGATAATTGCTAGCATGAAATCGGA
 
. : . : . : . : . : . :
JMFS123C10+ GAAGCGATCCCTTTCATGAATTTCATCCACAATGATGTGGGTAATGTCAGACATAGCATC
                      ____________________________________________________________
consensus GAAGCGATCCCTTTCATGAATTTCATCCACAATGATGTGGGTAATGTCAGACATAGCATC