Previous Contig 003877:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019H10Sequence586003877 (5)pir|T52602|T526025e-07squamosa promoter binding protein 1 [imported] - Arabidopsis thaliana>gb:ATH0116
JMFS092E12Sequence622003877 (5)
JMFS117F08Sequence604003877 (5)pir|T52602|T526022e-05squamosa promoter binding protein 1 [imported] - Arabidopsis thaliana>gb:ATH0116
JMFS122F12Sequence577003877 (5)
JMFS133G12Sequence626003877 (5)pir|T52602|T526026e-07squamosa promoter binding protein 1 [imported] - Arabidopsis thaliana>gb:ATH0116

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS019H10+ TGATGATGGGTTGGGATTGAGAG
JMFS133G12+ GGTAATTTGATGATGGGTTGGGATTGAGAG
                      ____________________________________________________________
consensus GGTAATTTGATGATGGGTTGGGATTGAGAG
 
. : . : . : . : . : . :
JMFS019H10+ GTCTGGCAAGGAAAAGATGGCCATCCCATTTCCAATCACTGGGATCCCACTCCAGACTCC
JMFS133G12+ GTCTGGCAAGGAAAAGATGGCCATCCCATTTCCAATCACTGGGATCCCACTCCAGACTCC
JMFS117F08+ AAAGATGGCCATCCCATTTCCAATCACTGGGATCCCACTCCAGACTCC
JMFS092E12+ CAGACTCC
                      ____________________________________________________________
consensus GTCTGGCAAGGAAAAGATGGCCATCCCATTTCCAATCACTGGGATCCCACTCCAGACTCC
 
. : . : . : . : . : . :
JMFS019H10+ TTTTCCCCACCGCTCTCAAATCCGCTGCACCCAAATCATAAAAGAGTTGAGCTTGACCTC
JMFS133G12+ TTTTCCCCACCGCTCTCAAATCCGCTGCACCCAAATCATAAAAGAGTTGAGCTTGACCTC
JMFS117F08+ TTTTCCCCACCGCTCTCAAATCCGCTGCACCCAAATCATAAAAGAGTTGAGCTTGACCTC
JMFS092E12+ TTTTCCCCACCGCTCTCAAATCCGCTGCACCCAAATCATAAAAGAGTTGAGCTTGAACTC
                      ____________________________________________________________
consensus TTTTCCCCACCGCTCTCAAATCCGCTGCACCCAAATCATAAAAGAGTTGAGCTTGACCTC
 
. : . : . : . : . : . :
JMFS019H10+ CAATTCTGGCCTCCATTTATGGGATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
JMFS133G12+ CAATTCTGGCCTCCATTTATGGGATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
JMFS117F08+ CAATTCTGGCCTCCATTTATGGGATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
JMFS092E12+ CAATTCTGGCCTCCATTTATGGGATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
JMFS122F12+ ATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
                      ____________________________________________________________
consensus CAATTCTGGCCTCCATTTATGGGATTACCAGATTTCCAACACTCTAATATTGATAAAAGC
 
. : . : . : . : . : . :
JMFS019H10+ CCCCAAAATACTATAAAGAAAGAAAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
JMFS133G12+ CCCCAAAATACTATAAAGAAAGAAAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
JMFS117F08+ CCCCAAAATACTATAAAGAAAGAAAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
JMFS092E12+ CCCCAAAATACTATAAAGAAAGAAAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
JMFS122F12+ CCCCAAAATACTATAAAGAAAGANAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
                      ____________________________________________________________
consensus CCCCAAAATACTATAAAGAAAGAAAATTAAAAAAGTCGAAATCTTTTAGCAGGCACAACA
 
. : . : . : . : . : . :
JMFS019H10+ GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
JMFS133G12+ GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
JMFS117F08+ GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
JMFS092E12+ GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
JMFS122F12+ GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
                      ____________________________________________________________
consensus GATCAGAGTCGAAAATTCCCAAATCTCAGCCAAAAGGAGAAAGACCTTAAATGAAGCTAA
 
. : . : . : . : . : . :
JMFS019H10+ TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
JMFS133G12+ TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
JMFS117F08+ TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
JMFS092E12+ TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
JMFS122F12+ TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
                      ____________________________________________________________
consensus TCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCAA
 
. : . : . : . : . : . :
JMFS019H10+ TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
JMFS133G12+ TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
JMFS117F08+ TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
JMFS092E12+ TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
JMFS122F12+ TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
                      ____________________________________________________________
consensus TTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTCA
 
. : . : . : . : . : . :
JMFS019H10+ GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
JMFS133G12+ GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
JMFS117F08+ GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
JMFS092E12+ GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
JMFS122F12+ GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
                      ____________________________________________________________
consensus GTCTTGATAACGAACTGCCTCCATACCTCAATTAAGCAAATTGAGCACCGTAAATTCATT
 
. : . : . : . : . : . :
JMFS019H10+ AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
JMFS133G12+ AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
JMFS117F08+ AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
JMFS092E12+ AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
JMFS122F12+ AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
                      ____________________________________________________________
consensus AATGAAATGAAATCAGTTAAAACTCGGAGTTGGGAGAAAAAAATAGATACAACTAAATCT
 
. : . : . : . : . : . :
JMFS019H10+ TACAGGAACGACCGAGATAAGGA
JMFS133G12+ TACAGGAACGACCGAGATAAGGATGGACGGAAAGCGGCGAACGGCGGGGAGTTGGG
JMFS117F08+ TACAGGAACGACCGAGATAAGGATGGACGGAAAGCGGCGAACGGCGGGGAGTTGGGCAGA
JMFS092E12+ TACAGGAACGACCGAGATAAGGATGGACGGAAAGCGGCGAACGGCGGGGAGTTGGGCAGA
JMFS122F12+ TACAGGAACGACCGAGATAAGGATGGACGGAAAGCGGCGAACGGCGGGGAGTTGGGCAGA
                      ____________________________________________________________
consensus TACAGGAACGACCGAGATAAGGATGGACGGAAAGCGGCGAACGGCGGGGAGTTGGGCAGA
 
. : . : . : . : . : . :
JMFS117F08+ GGATGGTTGTAGCTAA
JMFS092E12+ GGATGGTTGTAGCTAAAGCCTAAAGCCGAAAGGTTGGGTGGGATGAGGATGATAAGATGG
JMFS122F12+ GGATGGTTGTAGCTAAAGCCTAAAGCCGAAAGGTTGGGTGGGATGAGGATGATAAGATGG
                      ____________________________________________________________
consensus GGATGGTTGTAGCTAAAGCCTAAAGCCGAAAGGTTGGGTGGGATGAGGATGATAAGATGG
 
. : . : . : . : . : . :
JMFS092E12+ CGAATGTGAATGCC
JMFS122F12+ CGAATGTGAATGCCGTGGTGGGGTAGGAAGAGAGAGAGAGAGAGTGGCGAGTATGCTGTT
                      ____________________________________________________________
consensus CGAATGTGAATGCCGTGGTGGGGTAGGAAGAGAGAGAGAGAGAGTGGCGAGTATGCTGTT