Previous Contig 003861:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046H11Sequence569003861 (17)gb:AY099560_15765862e-40Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.183010884 (9)
JMFF049C20Sequence633003861 (17)gb:AY099560_15765867e-50Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.569010884 (9)gb:AJ698933_18134659e-19Populus deltoides x Populus maximowiczii partial mRNA for hypothetical protein.
JMFS001G06Sequence577003861 (17)gb:AY099560_15765861e-52Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS008F05Sequence627003861 (17)gb:AY099560_15765864e-51Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS022H03Sequence607003861 (17)gb:AY099560_15765862e-49Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS024H04Sequence589003861 (17)gb:AY099560_15765862e-44Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS030D08Sequence633003861 (17)gb:AY099560_15765865e-54Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS039H07Sequence608003861 (17)gb:AY099560_15765864e-83Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS060H09Sequence642003861 (17)gb:AY099560_15765864e-55Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS098F07Sequence627003861 (17)gb:AY099560_15765866e-47Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS109B04Sequence620003861 (17)gb:AY099560_15765861e-57Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMFS120H10Sequence625003861 (17)gb:AY099560_15765865e-33Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.
JMSF001I06Sequence296003861 (17)728010884 (9)gb:AY064997_15661667e-64Arabidopsis thaliana At2g47390/T8I13.23 mRNA, complete cds.>gb:BT002650_1636253
JMSF001I12Sequence287003861 (17)753021981gb:AJ698933_18134653e-28Populus deltoides x Populus maximowiczii partial mRNA for hypothetical protein.
JMSF021E09Sequence671003861 (17)gb:AY099560_15765862e-52Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.771010884 (9)gb:AY064997_15661662e-81Arabidopsis thaliana At2g47390/T8I13.23 mRNA, complete cds.>gb:BT002650_1636253
JMSF039F22Sequence652003861 (17)gb:AY099560_15765868e-52Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.816010884 (9)gb:AY064997_15661665e-90Arabidopsis thaliana At2g47390/T8I13.23 mRNA, complete cds.>gb:BT002650_1636253
JMSF043A08Sequence649003861 (17)gb:AY099560_15765862e-51Arabidopsis thaliana unknown protein (At2g47390) mRNA, partial cds.663010884 (9)gb:AY064997_15661666e-61Arabidopsis thaliana At2g47390/T8I13.23 mRNA, complete cds.>gb:BT002650_1636253

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS039H07+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFS039H07+ GATCTTGAAAGGTTCTAACTTGAATAATACTCTTCTGTTCATTAGATTGAACCTTAGGTC
                      ____________________________________________________________
consensus GATCTTGAAAGGTTCTAACTTGAATAATACTCTTCTGTTCATTAGATTGAACCTTAGGTC
 
. : . : . : . : . : . :
JMFS039H07+ CAGATGGAACCAAAGGCTTCTTTGGTGGATCTCCACGAGATAATGGGATGGTACAAACCA
                      ____________________________________________________________
consensus CAGATGGAACCAAAGGCTTCTTTGGTGGATCTCCACGAGATAATGGGATGGTACAAACCA
 
. : . : . : . : . : . :
JMFS039H07+ ATAGAGTCGAGTCATTCACCCAAACAAAGTTGTCAAAAATAGCATTTAGGTACACATCCG
                      ____________________________________________________________
consensus ATAGAGTCGAGTCATTCACCCAAACAAAGTTGTCAAAAATAGCATTTAGGTACACATCCG
 
. : . : . : . : . : . :
JMFS039H07+ TAGACTGGAACAGTGGTCTAGCAGTTCCTGTTTCCACATCAGCAACCCATACAGTCAACT
JMFS109B04+ GAACAGTGGTCTAGCAGTTCCTGTTTCCACATCAGCAACCCATACAGTCAACT
JMFS060H09+ CTAGCAGTTCCTGTTTCCACATCAGCAACCCATACAGTCAACT
JMFS008F05+ AACCCATACAGTCAACT
JMFS030D08+ AGTCAACT
                      ____________________________________________________________
consensus TAGACTGGAACAGTGGTCTAGCAGTTCCTGTTTCCACATCAGCAACCCATACAGTCAACT
 
. : . : . : . : . : . :
JMFS039H07+ TACTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
JMFS109B04+ TACTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
JMFS060H09+ TACTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
JMFS001G06+ TCCTCAACTCGAACATTGAAGGCTAAATAATGTCCATTAT
JMFS008F05+ TACTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
JMFS030D08+ TANTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
JMFS022H03+ AAATAATGTCCATTAT
JMFF049C20+ GCTAAATAATGTCCATTAT
JMSF039F22+ CGGACACTGAAGGCTAAATAATGTCCATTAT
JMSF043A08+ CACTGAAGGCTAAATAATGTCCATTAT
JMFS098F07+ T
JMSF021E09+ CTCGGACACTGAAGGCTAAATAATGTCCATTAT
                      ____________________________________________________________
consensus TACTACTGCTATTCTCCTCCTCCTCAACTCGGACACTGAAGGCTAAATAATGTCCATTAT
 
. : . : . : . : . : . :
JMFS039H07+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS109B04+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS060H09+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS001G06+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS008F05+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS030D08+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS022H03+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS024H04+ ATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFF049C20+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMSF039F22+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMSF043A08+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFS098F07+ TTGACCATGTAACANAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
JMFF046H11+ TGAATCAAC-TTTCAG
JMSF021E09+ TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
                      ____________________________________________________________
consensus TTGACCATGTAACAAAATTAATTTTAGCTCGTTCAGGTAGACCATGAATCAACTTTTCAG
 
. : . : . : . : . : . :
JMFS039H07+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS109B04+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS060H09+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS001G06+ GGCGTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS008F05+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS030D08+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS022H03+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS024H04+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFF049C20+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMSF039F22+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMSF043A08+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS098F07+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFF046H11+ GGCNTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMSF021E09+ GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
JMFS120H10+ CCTATACCAGTATAGAATGACATTC
                      ____________________________________________________________
consensus GGCCTAAGGTACCATCCTCCAGTAACTGATGGATCCCTATACCAGTATAGAATGACATTC
 
. : . : . : . : . : . :
JMFS039H07+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS109B04+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS060H09+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS001G06+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS008F05+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS030D08+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS022H03+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS024H04+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFF049C20+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMSF039F22+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMSF043A08+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS098F07+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFF046H11+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMSF021E09+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
JMFS120H10+ GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
                      ____________________________________________________________
consensus GACTCCGTGAATTACATTTCCCATCAATACGGATACCAGCAAGTTTCACCTCGGGCCTCG
 
. : . : . : . : . : . :
JMFS039H07+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS109B04+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS060H09+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS001G06+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS008F05+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS030D08+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS022H03+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS024H04+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFF049C20+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMSF039F22+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMSF043A08+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS098F07+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFF046H11+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMSF021E09+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
JMFS120H10+ CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
                      ____________________________________________________________
consensus CCAAGTCTGACAACGGTGGCAACGATCTCCGCTTGAGGAATAGTATTTTATCCCTCTGCG
 
. : . : . : . : . : . :
JMFS039H07+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS109B04+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS060H09+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS001G06+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS008F05+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS030D08+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS022H03+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS024H04+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFF049C20+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMSF039F22+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMSF043A08+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMFS098F07+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMSF001I12+ CTCTGGCGGAG
JMFF046H11+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
JMSF021E09+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGTGGAG
JMFS120H10+ GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
                      ____________________________________________________________
consensus GAGAGAACGATAGTGCTGGAACAGGCGGAGCATCTACAATATCTCGAATCTCTGGCGGAG
 
. : . : . : . : . : . :
JMFS039H07+ GAAGGCG
JMFS109B04+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS060H09+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS001G06+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS008F05+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS030D08+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS022H03+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS024H04+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFF049C20+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMSF039F22+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMSF043A08+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS098F07+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMSF001I12+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFF046H11+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMSF001I06+ GTCGTCATAAGAAGGATCAGCGGAAGCAA
JMSF021E09+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
JMFS120H10+ GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
                      ____________________________________________________________
consensus GAAGGCGATACTGATTCCCTAATGCTTCATCGTCGTCATAAGAAGGATCAGCGGAAGCAA
 
. : . : . : . : . : . :
JMFS109B04+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS060H09+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS001G06+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS008F05+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS030D08+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS022H03+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS024H04+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFF049C20+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMSF039F22+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMSF043A08+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS098F07+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMSF001I12+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFF046H11+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMSF001I06+ CGGCGCCGTNAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACNNCAGTGAGCGGNA
JMSF021E09+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
JMFS120H10+ CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
                      ____________________________________________________________
consensus CGGCGCCGTTAGCGGCGGAAGCTCCACCGCCGTCCTCGTTTCCGACGGCAGTGAGCGGGA
 
. : . : . : . : . : . :
JMFS109B04+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS060H09+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS001G06+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS008F05+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS030D08+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS022H03+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS024H04+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFF049C20+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMSF039F22+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMSF043A08+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS098F07+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMSF001I12+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFF046H11+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMSF001I06+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGANTG
JMSF021E09+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
JMFS120H10+ CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
                      ____________________________________________________________
consensus CAAGATGAGGGGATCTGGAGGAGGCGGGCATGGCGGAGATTCCCGAAAGATGGCGGATTG
 
. : . : . : . : . : . :
JMFS109B04+ ATGGAAGGGATTTGCGGGGGGAAGAGA
JMFS060H09+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTG
JMFS001G06+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAA-TGGAAGGGAAGAGGGGAATATGGGTT
JMFS008F05+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFS030D08+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFS022H03+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFS024H04+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFF049C20+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMSF039F22+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMSF043A08+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFS098F07+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMSF001I12+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFF046H11+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMSF001I06+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGGAGAGGGGAATATGGGTTTGA
JMSF021E09+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
JMFS120H10+ ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
                      ____________________________________________________________
consensus ATGGAAGGGATTTGCGGGGGGAAGAGAGAATTGGAAGGGAAGAGGGGAATATGGGTTTGA
 
. : . : . : . : . : . :
JMFS008F05+ AGGAGTGAGG
JMFS030D08+ AGGAGTGAGGGAGAAGGGGGCAGAG
JMFS022H03+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGAT
JMFS024H04+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMFF049C20+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMSF039F22+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMSF043A08+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMFS098F07+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMSF001I12+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGC
JMFF046H11+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMSF001I06+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACNGTGATGAAANGAGA
JMSF021E09+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
JMFS120H10+ AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
                      ____________________________________________________________
consensus AGGAGTGAGGGAGAAGGGGGCAGAGAGAGGCGAGCAGAGAGAAACGGTGATGAAAGGAGA
 
. : . : . : . : . : . :
JMFS024H04+ CGACT
JMFF049C20+ CGACTTTGTGAAT
JMSF039F22+ CGACTTTGTGAATGGGTC
JMSF043A08+ CGACTTTGTGAATGGGTCTC
JMFS098F07+ CGACTTTGTGAATGGGTCTCATCGTC
JMFF046H11+ CGACTTTGTGAAT
JMSF001I06+ CGACTTTGTGAATGGGTCTCATCGTC
JMSF021E09+ CGACTTTGTGAATGGGTCTCATCGTCGTCGTCATCAT
JMFS120H10+ CGACTTTGTGAATGGGTCTCATCGTCGTCGTCATCATGTCATTACAATTAACAATTACAT
                      ____________________________________________________________
consensus CGACTTTGTGAATGGGTCTCATCGTCGTCGTCATCATGTCATTACAATTAACAATTACAT
 
. : . : . : . : . : . :
JMFS120H10+ TCCAATTCATTAACAATTTCCTTTTCCACTCCACAGTCCACAGCACAGCACTAGAACCAA
                      ____________________________________________________________
consensus TCCAATTCATTAACAATTTCCTTTTCCACTCCACAGTCCACAGCACAGCACTAGAACCAA