Previous Contig 003857:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS120C02Sequence554003857 (4)pir|E84847|E848473e-04probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana
JMFS164H12Sequence601003857 (4)pir|E84847|E848474e-13probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana
JMSF014O17Sequence277003857 (4)
JMSF027E11Sequence664003857 (4)pir|E84847|E848472e-39probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027E11+ ACAATCGGGTCAGCCCCTGCTGACAACAGCAACTTCACCACTT
                      ____________________________________________________________
consensus ACAATCGGGTCAGCCCCTGCTGACAACAGCAACTTCACCACTT
 
. : . : . : . : . : . :
JMSF027E11+ CAGAGGCATTAACAGAACCACCAGACGTCGCACAGTGAAGAGCCGTGATCTTGTCTGGCC
                      ____________________________________________________________
consensus CAGAGGCATTAACAGAACCACCAGACGTCGCACAGTGAAGAGCCGTGATCTTGTCTGGCC
 
. : . : . : . : . : . :
JMSF027E11+ CACAAGCTCGATTAACATCCACTCCAGGCTGAGCAAGAATCAACCTCAAGACATCAACAC
                      ____________________________________________________________
consensus CACAAGCTCGATTAACATCCACTCCAGGCTGAGCAAGAATCAACCTCAAGACATCAACAC
 
. : . : . : . : . : . :
JMSF027E11+ TACCATAAGTGGCAGCAACCATCAAAGGAGTCCTTTCCTCATTAACAACCTGCTTCGAGC
JMFS164H12+ AGTCCTTTCCTCATTAACAACCTGCTTCGAGC
                      ____________________________________________________________
consensus TACCATAAGTGGCAGCAACCATCAAAGGAGTCCTTTCCTCATTAACAACCTGCTTCGAGC
 
. : . : . : . : . : . :
JMSF027E11+ CCTTCTTTCGGACTAACCAAAGCCCAACCGAGTCAACCCCACACGAATCACACTCAATAG
JMFS164H12+ CCTTCTTTCGGACTAACCAAAGCCCAACCGAGTCAACCCCACACGAATCACACTCAATAG
JMFS120C02+ ATCACACTCAATAG
                      ____________________________________________________________
consensus CCTTCTTTCGGACTAACCAAAGCCCAACCGAGTCAACCCCACACGAATCACACTCAATAG
 
. : . : . : . : . : . :
JMSF027E11+ ACCGCTTAAACGCATCTACATCATTGTTTGCAGCAAGCTCAAGTAAACTAGAAAAAGCAT
JMFS164H12+ ACCGCTTAAACGCATCTACATCATTGTTTGCAGCAAGCTCAAGTAAACTAGAAAAAGCAT
JMFS120C02+ TCCGCTTAAACGCATCTACATCATTGTTTGCAGCAAGCTCAAGTAAACTAGAAAAAGCAT
                      ____________________________________________________________
consensus ACCGCTTAAACGCATCTACATCATTGTTTGCAGCAAGCTCAAGTAAACTAGAAAAAGCAT
 
. : . : . : . : . : . :
JMSF027E11+ CATCAGTCTCAATGGTATCCTTGCACATGTCCTTCATACTAGATTTGGTATCAGAACAAG
JMSF014O17+ ATCAGAACAAG
JMFS164H12+ CATCAGTCTCAATGGTATCCTTGCACATGTCCTTCATACTAGATTTGGTATCAGAACAAG
JMFS120C02+ CATCAGTCTCAATGGTATCCTTGCACATGTCCTTCATACTAGATTTGGTATCAGAACAAG
                      ____________________________________________________________
consensus CATCAGTCTCAATGGTATCCTTGCACATGTCCTTCATACTAGATTTGGTATCAGAACAAG
 
. : . : . : . : . : . :
JMSF027E11+ ATTGGTTGGTAGCTGTAGCAGAATTTGATTGCTCTGGGCCACTGCACATGGTTCAGTCAC
JMSF014O17+ ATTGGTTGGTAGCTGTAGCAGAATTTGATTGCTCTGGGCCACTGCACATGGTTCAGTCAC
JMFS164H12+ ATTGGTTGGTAGCTGTAGCAGAATTTGATTGCTCTGGGCCACTGCACATGGTTCAGTCAC
JMFS120C02+ ATTGGTTGGTAGCTGTAGCAGAATTTGATTGCTATGGGCCACTGCACATGGTTCAGTCAC
                      ____________________________________________________________
consensus ATTGGTTGGTAGCTGTAGCAGAATTTGATTGCTCTGGGCCACTGCACATGGTTCAGTCAC
 
. : . : . : . : . : . :
JMSF027E11+ CAATATTCATCAACAGAAGCGCCGCACAGATCCGCGGAGAGGGAAAGGGAGGCGGACGGA
JMSF014O17+ CAATATTCATCAACAGAAGCGCCGCACAGATCCGCGGAGAGGGAAAGGGAGGCGGACGGA
JMFS164H12+ CAATATTCATCAACAGAAGCGCCGCACAGATCCGCGGAGAGGGAAAGGGAGGCGGACGGA
JMFS120C02+ CAATATTCATCAACAGAAGCGCCGCACAGATCCGCGGATAGGGAAAGGGAGGCGGACGGA
                      ____________________________________________________________
consensus CAATATTCATCAACAGAAGCGCCGCACAGATCCGCGGAGAGGGAAAGGGAGGCGGACGGA
 
. : . : . : . : . : . :
JMSF027E11+ GACTTCAACACAGCAAGGCGGCTACGGCGACCGGAGATTCACTTCCGATGTGGATCATAT
JMSF014O17+ GACTTCAACACAGCAAGGCGGCTACGGCGACCGGAGATTCACTTCCGATGTGGATCATAT
JMFS164H12+ GACTTCAACACAGCAAGGCGGCTACGGCGACCGGAGATTCACTTCCGATGTGGATCATAT
JMFS120C02+ GACTTCAACACAGCAAGGCGGCTACGGCGACCGGAGATTCACTTCCGATGTGGATCATAT
                      ____________________________________________________________
consensus GACTTCAACACAGCAAGGCGGCTACGGCGACCGGAGATTCACTTCCGATGTGGATCATAT
 
. : . : . : . : . : . :
JMSF027E11+ CCACCGTCTGTCGCTCCAACTCCAACAGCAACCGAGAGCGAATAGCACTCCCATGATAAT
JMSF014O17+ CCACCGTCTGTCGCTCCAACTCCAACAGCAACCGAGAGCGAATAGCACTCCCATGATAAT
JMFS164H12+ CCACCGTCTGTCGCTCCAACTCCAACAGCAACCGAGAGCGAATAGCACTCCCATGATAAT
JMFS120C02+ CCACCGTCTGTCGCTCCAACTCCAACAGCAACCGAGAGCGAATAGCACTCCCATGATAAT
                      ____________________________________________________________
consensus CCACCGTCTGTCGCTCCAACTCCAACAGCAACCGAGAGCGAATAGCACTCCCATGATAAT
 
. : . : . : . : . : . :
JMSF027E11+ TTCTACACGCAAAAAGCTC
JMSF014O17+ TTCTACACGCAAAAAGCTC
JMFS164H12+ TTCTACACGCAAAAAGCTCCGGCCTGCGTATGCGTACGTCGTATACCTATATATATATGT
JMFS120C02+ TTCTACACGCAAAAAGCTCCGGCCTGCGTATGCGTACGTCGTATACCTATATATATATGT
                      ____________________________________________________________
consensus TTCTACACGCAAAAAGCTCCGGCCTGCGTATGCGTACGTCGTATACCTATATATATATGT
 
. : . : . : . : . : . :
JMFS164H12+ ATATAATCCGTTGCGTGTCTATATAGGTAGAGATAAACAGTGAGACAAGAAGATCGGAAG
JMFS120C02+ ATATAATCCGTTGCGTGTCTATATAGGTAGAGATAACCAGTGAGACAAGAAGATCGGAAG
                      ____________________________________________________________
consensus ATATAATCCGTTGCGTGTCTATATAGGTAGAGATAACCAGTGAGACAAGAAGATCGGAAG
 
. : . : . : . : . : . :
JMFS164H12+ ACAGTGACAGACCTAGAGAGAGAAAGCAA
JMFS120C02+ ACAGTGACAGACCTAGAGAGAGAAAGCAAGAGAGATAGAGAGAGGGAAATGAAATGAAAT
                      ____________________________________________________________
consensus ACAGTGACAGACCTAGAGAGAGAAAGCAAGAGAGATAGAGAGAGGGAAATGAAATGAAAT