Previous Contig 003856:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS006G10Sequence343003856 (4)
JMFS013F04Sequence551003856 (4)
JMFS120B09Sequence624003856 (4)
JMFS141C04Sequence256003856 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS006G10+ AATTCATCACCAATCAACTGCTAATTCCAACTACCAACA
JMFS013F04+ CAACA
JMFS120B09+ AACTGCTAATTCCAACTACCAACA
                      ____________________________________________________________
consensus AATTCATCACCAATCAACTGCTAATTCCAACTACCAACA
 
. : . : . : . : . : . :
JMFS006G10+ AAATTATAATAAAATCCCTGCAAGTTCTCTGCTTCAGATAGTCTACACTCCCAGAAAAAA
JMFS013F04+ AAATTATAATAAAATCCCTACAAGTTCTCTGCTTCAGATAGTCTACACTCCCAGAAAAAA
JMFS120B09+ AAATTATAATAAAATCCCTACAAGTTCTCTGCTTCAGATAGTCTACACTCCCAGAAAAAA
                      ____________________________________________________________
consensus AAATTATAATAAAATCCCTACAAGTTCTCTGCTTCAGATAGTCTACACTCCCAGAAAAAA
 
. : . : . : . : . : . :
JMFS006G10+ AGATGATCACCAACATACAAAAACCATAGTCTTGGTACTCCACTGGCATGCAAATGCAAA
JMFS013F04+ AGATGATCACCAACATACAAAAACCATAGTCTTGGTACTCCACTGGCATGCAAATGCAAA
JMFS120B09+ AGATGATCACCAACATACAAAAACCATAGTCTTGGTACTCCACTGGCATGCAAATGCAAA
                      ____________________________________________________________
consensus AGATGATCACCAACATACAAAAACCATAGTCTTGGTACTCCACTGGCATGCAAATGCAAA
 
. : . : . : . : . : . :
JMFS006G10+ ACAAAAAGATCAAACCCAAATCTGAGAACAGGCAAGACAACTAACCGGTTTCTGCATAAA
JMFS013F04+ ACAAAAAGATCAAACCCAAATCTGAGAACAGGCAAGACAACTAACCGGTTTCTGCATAAA
JMFS120B09+ ACAAAAAGATCAAACCCAAATCTGAGAACAGGCAAGACAACTAACCGGTTTCTGCATAAA
                      ____________________________________________________________
consensus ACAAAAAGATCAAACCCAAATCTGAGAACAGGCAAGACAACTAACCGGTTTCTGCATAAA
 
. : . : . : . : . : . :
JMFS006G10+ CAGTAACTAACAAAAATACCCTCTACTCAATTCACCTCAAAAAATATCTGGAAATCCCGC
JMFS013F04+ CAGTAACTAACAAAAATACCCTCTACTCAATTCACCTCAAAAAATATCTGGAAATCCCGC
JMFS120B09+ CAGTAACTAACAAAAATACCCTCTACTCAATTCACCTCAAAAAATATCTGGAAATCCCGC
                      ____________________________________________________________
consensus CAGTAACTAACAAAAATACCCTCTACTCAATTCACCTCAAAAAATATCTGGAAATCCCGC
 
. : . : . : . : . : . :
JMFS006G10+ AATTCATATGCGTAACAATTGAACAACCTACCCAAGGGCCGAGAACAAATAAAAATCCAA
JMFS141C04+ ACAAATAAAAATCCAA
JMFS013F04+ AATTCATATGCGTAACAATTGAACAACCTACCCAAGGGCCGAGAACAAATAAAAATCCAA
JMFS120B09+ AATTCATATGCGTAACAATTGAACAACCTACCCAAGGGCCGAGAACAAATAAAAATCCAA
                      ____________________________________________________________
consensus AATTCATATGCGTAACAATTGAACAACCTACCCAAGGGCCGAGAACAAATAAAAATCCAA
 
. : . : . : . : . : . :
JMFS006G10+ TCTT
JMFS141C04+ TCTTTCCTAGAATAAGTGATCTGAATTGGTGAGAAGCAGCTGAATATTAGTAGAACGAAA
JMFS013F04+ TCTTTCCTAGAATAAGTGATCTGAATTACTGAGAAGCAGCTGAATATTAGTAAAACGAAA
JMFS120B09+ TCTTTCCTAGAATAAGTGATCTGAATTACTGAGAAGCAGCTGAATATTAGTAAAACGAAA
                      ____________________________________________________________
consensus TCTTTCCTAGAATAAGTGATCTGAATTACTGAGAAGCAGCTGAATATTAGTAAAACGAAA
 
. : . : . : . : . : . :
JMFS141C04+ AACGGGCACTTGAATTGAGCATTGATAAGTACATGGGGGGAGTGAAGCCGAGGAAACAGA
JMFS013F04+ AACGGGCACTTGAATTGAGCATTGATAAGTACATGGGGGGAGTGAAGCCGAGGAAACAGA
JMFS120B09+ AACGGGCACTTGAATTGAGCATTGATAAGTACATGGGGGGAGTGAAGCCGAGGAAACAGA
                      ____________________________________________________________
consensus AACGGGCACTTGAATTGAGCATTGATAAGTACATGGGGGGAGTGAAGCCGAGGAAACAGA
 
. : . : . : . : . : . :
JMFS141C04+ GGAGACCCAGGTGAGATACACGTTATGGGTTCTTGATTTCACGGCGGCGGATGGGCATTT
JMFS013F04+ GGAGACCCAGGTGAGATACACGTTATGGGTTCTTGATTTCACGGCGGCGGATGGGCATTT
JMFS120B09+ GGAGACCCAGGTGAGATACACGTTATGGGTTCTTGATTTCACGGCGGCGGATGGGCATTT
                      ____________________________________________________________
consensus GGAGACCCAGGTGAGATACACGTTATGGGTTCTTGATTTCACGGCGGCGGATGGGCATTT
 
. : . : . : . : . : . :
JMFS141C04+ GTGAGAATGATCAAACAAATAAACTGAGAAAAAAAAAAAAAAAAAAGGAGTGGCTGAGCT
JMFS013F04+ CTGAGAATGATCAAACAAATAAACTGAGAAAAAAAAAAAAAAAAAAGGAGTGGCTGAGCT
JMFS120B09+ CTGAGAATGATCAAACAAATAAACTGAGAAAAAAAAAAAAAAAAAAGGAGTGGCTGAGCT
                      ____________________________________________________________
consensus CTGAGAATGATCAAACAAATAAACTGAGAAAAAAAAAAAAAAAAAAGGAGTGGCTGAGCT
 
. : . : . : . : . : . :
JMFS120B09+ GCACAGCTGACTGCGTCTTTCAGCGCACAATGAAATAGAGAGAGAAGTTTAATGGTGTAG
                      ____________________________________________________________
consensus GCACAGCTGACTGCGTCTTTCAGCGCACAATGAAATAGAGAGAGAAGTTTAATGGTGTAG