Previous Contig 003853:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005G13Sequence519003853 (11)gb:AY136389_15818903e-48Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188707008557 (12)gb:AY136389_15818904e-25Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFF008I06Sequence571003853 (11)gb:AY136389_15818904e-61Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188720008557 (12)gb:AY136389_15818904e-22Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFF037D20Sequence500003853 (11)gb:AY136389_15818902e-64Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFF049N10Sequence638003853 (11)gb:AY136389_15818909e-64Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188589008557 (12)gb:AY136389_15818902e-09Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFS014C08Sequence533003853 (11)gb:AY136389_15818901e-59Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFS119H12Sequence622003853 (11)gb:AY136389_15818903e-62Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMFS140G07Sequence612003853 (11)gb:AY136389_15818908e-65Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMSF014O18Sequence282003853 (11)gb:AY136389_15818903e-20Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188745008557 (12)gb:AY136389_15818906e-26Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMSF025N04Sequence618003853 (11)gb:AY136389_15818901e-63Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188696008557 (12)gb:AY136389_15818906e-26Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMSF050L20Sequence678003853 (11)gb:AY136389_15818906e-76Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188675008557 (12)gb:AY136389_15818909e-22Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188
JMSF050M20Sequence689003853 (11)gb:AY136389_15818905e-79Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188676008557 (12)gb:AY136389_15818901e-17Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050M20+ TCCGGGAAACTGAAC
JMSF050L20+ GAAC
                      ____________________________________________________________
consensus TCCGGGAAACTGAAC
 
. : . : . : . : . : . :
JMSF050M20+ GGGATGTTCAGGGTAAACTGCCCATCATGGTACAGTAACTTCTGAGACCATCTAATAGTG
JMSF050L20+ NGGATGTTCAGGGTAAACTGNCCATCATGGTACAGTAACTTCTGAGACCATCTAATAGTG
                      ____________________________________________________________
consensus GGGATGTTCAGGGTAAACTGCCCATCATGGTACAGTAACTTCTGAGACCATCTAATAGTG
 
. : . : . : . : . : . :
JMFF037D20+ CGAGGGTAAAAATGTTGGGATTC
JMSF050M20+ ACTAAAAGATTGGTACCCCCATCAATCTCTGGTATTTCGAGGGTAAAAATGTTGGGATTC
JMSF050L20+ ACTAAAAGATTGGTACCCCCATCAATCTCTGGTATTTCGAGGGTAAAAATGTTGGGATTC
JMFS140G07+ TACCCCCATCAATCTCTGGTATTTCGAGGGTAAAAATG-TGGGATTC
JMSF025N04+ CTCTGGTATTTCGAGGGTAAAAATGTTGGGATTC
JMFF049N10+ TGGGATTC
                      ____________________________________________________________
consensus ACTAAAAGATTGGTACCCCCATCAATCTCTGGTATTTCGAGGGTAAAAATGTTGGGATTC
 
. : . : . : . : . : . :
JMFF037D20+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMSF050M20+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMSF050L20+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMFS140G07+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMSF025N04+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMFF049N10+ AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
JMFF008I06+ ACTAGTTCA
JMFS119H12+ ATCATCTACAGCAACTAGTTCA
                      ____________________________________________________________
consensus AAATAGTATCCATCCTCAAATTTGGCTGTTTCCTTTTTATCATCTACAGCAACTAGTTCA
 
. : . : . : . : . : . :
JMFF037D20+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMSF050M20+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMSF050L20+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMFS140G07+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMSF025N04+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMFF049N10+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMFS014C08+ GGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMFF008I06+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
JMFS119H12+ GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
                      ____________________________________________________________
consensus GTATGGTAATGTTTCCCGGGCACCTCAACCTCGAGACCTAGAATCGAACCCTGTTCGCCC
 
. : . : . : . : . : . :
JMFF037D20+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMSF050M20+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMSF050L20+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFS140G07+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMSF025N04+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFF049N10+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFS014C08+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFF008I06+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFF005G13+ ACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
JMFS119H12+ ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
                      ____________________________________________________________
consensus ATCGGAATGGCAATACGACAATCGCAGCTGCGGCTGCCCATGACGCAGTGCACGCGCCAG
 
. : . : . : . : . : . :
JMFF037D20+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMSF050M20+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMSF050L20+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFS140G07+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMSF025N04+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFF049N10+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFS014C08+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFF008I06+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFF005G13+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
JMFS119H12+ GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
                      ____________________________________________________________
consensus GATCCGGTGACGGTGACGAACGCCGTGTCCAGATAACACTCGGCGGCGACAGAAATGCTG
 
. : . : . : . : . : . :
JMFF037D20+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMSF050M20+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMSF050L20+ TTCATCTGCAGAGGAATCAGCGNGGGAGGGTCGCATCTNCCGTGCACGTGAGGCTGGTAG
JMFS140G07+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMSF025N04+ TTCATCTGCAGAGGAAT-AGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMFF049N10+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMFS014C08+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMFF008I06+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMSF014O18+ GCACGTGAGGCTGGTAG
JMFF005G13+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
JMFS119H12+ TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
                      ____________________________________________________________
consensus TTCATCTGCAGAGGAATCAGCGCGGGAGGGTCGCATCTGCCGTGCACGTGAGGCTGGTAG
 
. : . : . : . : . : . :
JMFF037D20+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMSF050M20+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMSF050L20+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFS140G07+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMSF025N04+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFF049N10+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFS014C08+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFF008I06+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMSF014O18+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFF005G13+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
JMFS119H12+ CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
                      ____________________________________________________________
consensus CTCGGAACGTCCGGGTTGTCCACCACGGCGGGGTTCTCAATAACGGCGTAGAGCATTGGA
 
. : . : . : . : . : . :
JMFF037D20+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMSF050M20+ GCTGATGGAAGGTAGGAGTGAGCCGTC-TCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMSF050L20+ GCTGATGGAAGGTAGGAGTGAGCCGTC-TCTCCATGGCCGTCATCGCTCTNGGCGGCGCC
JMFS140G07+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCGTCGCTCTCGGCGGCGCC
JMSF025N04+ GCTGATGGAAGGTAGGAGTGAGCCGTNTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMFF049N10+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMFS014C08+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMFF008I06+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMSF014O18+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMFF005G13+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
JMFS119H12+ GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
                      ____________________________________________________________
consensus GCTGATGGAAGGTAGGAGTGAGCCGTCTTCTCCATGGCCGTCATCGCTCTCGGCGGCGCC
 
. : . : . : . : . : . :
JMFF037D20+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACG
JMSF050M20+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMSF050L20+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFS140G07+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMSF025N04+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFF049N10+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFS014C08+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFF008I06+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMSF014O18+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCCTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFF005G13+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
JMFS119H12+ ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
                      ____________________________________________________________
consensus ACTGCCCTGTCCTTCCCGAAGTTTATCCGCTTCGAAAGCCGCAGCCCGTCCTCCACGGCG
 
. : . : . : . : . : . :
JMSF050M20+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMSF050L20+ GCGGCGAATTCCCCCGCCATGACNCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFS140G07+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMSF025N04+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFF049N10+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFS014C08+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFF008I06+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMSF014O18+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFF005G13+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
JMFS119H12+ GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
                      ____________________________________________________________
consensus GCGGCGAATTCCCCCGCCATGACGCCGCGCGCTTAGGAAATTGAAGGTCTTCGAATTGGA
 
. : . : . : . : . : . :
JMSF050M20+ GATCGCCGGAAG
JMSF050L20+ GATCGCCGGAAG
JMFS140G07+ GATCGCCGGAAGGCAACGCTGCCGTG
JMSF025N04+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCC
JMFF049N10+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
JMFS014C08+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
JMFF008I06+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
JMSF014O18+ GATCGCCGGAAGGCAACGCT
JMFF005G13+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
JMFS119H12+ GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
                      ____________________________________________________________
consensus GATCGCCGGAAGGCAACGCTGCCGTGCTGCTTCGTTGTCGCCTTTTTATTTCGTCGACAC
 
. : . : . : . : . : . :
JMFF049N10+ GTTGACCGGTTTTATCTTTCGT
JMFS014C08+ GTTGA
JMFF008I06+ GTTGACCGGTTTTATCTTTCGT
JMFF005G13+ GTTGACCGGTTTTATCTTTCGTAAATGACAAACAAAACTAAAAAAACCGGGATAAC
JMFS119H12+ GTTGACCGGTTTTATCTTTCGTAAATGACAAACAAAACTAAAAAAACCGGGATAACAGCG
                      ____________________________________________________________
consensus GTTGACCGGTTTTATCTTTCGTAAATGACAAACAAAACTAAAAAAACCGGGATAACAGCG