Previous Contig 003845:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039F02Sequence627003845 (7)gb:AY035039_15598172e-38Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.
JMFS092B10Sequence627003845 (7)gb:AY035039_15598171e-04Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.
JMFS118D07Sequence629003845 (7)gb:AY035039_15598172e-04Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.
JMFS119A05Sequence605003845 (7)gb:AY035039_15598173e-06Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.
JMFS122B02Sequence586003845 (7)gb:AP002046_18216251e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MMP21.
JMFS123C03Sequence572003845 (7)gb:AY035039_15598170.026Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.
JMFS139F10Sequence626003845 (7)gb:AY035039_15598174e-34Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS122B02+ CCTATGG
                      ____________________________________________________________
consensus CCTATGG
 
. : . : . : . : . : . :
JMFS122B02+ AAGGGGTTTGGATGGTTAGCCCAATGGTTTTGTAGCCGGTTATTTAGAGATGGACCAGAA
                      ____________________________________________________________
consensus AAGGGGTTTGGATGGTTAGCCCAATGGTTTTGTAGCCGGTTATTTAGAGATGGACCAGAA
 
. : . : . : . : . : . :
JMFS122B02+ GAGGTTAACTGTGGTATGTTTCCATTGTAGTGGACCCTGTGGGGCAGGCTAGATAACTGC
JMFS139F10+ TTGTAGTGGACCCTGTGGGGCAGGCTAGATAACTGC
                      ____________________________________________________________
consensus GAGGTTAACTGTGGTATGTTTCCATTGTAGTGGACCCTGTGGGGCAGGCTAGATAACTGC
 
. : . : . : . : . : . :
JMFS122B02+ TTGTTTGAGCTTGACATAGAAGAGAGATCTGCAGAAGAGAAGGGTGACTGATGCCCATGT
JMFS139F10+ TTGTTTGAGCTTGACATAGAAGAGAGATCTGCAGAAGAGAAGGGTGACTGATGCCCATGT
                      ____________________________________________________________
consensus TTGTTTGAGCTTGACATAGAAGAGAGATCTGCAGAAGAGAAGGGTGACTGATGCCCATGT
 
. : . : . : . : . : . :
JMFS122B02+ GATGAAAGATCATAGTGATGGGAAAGACTGCGCGGTGAAGCCTGCTGTGATCTGCCACCA
JMFS139F10+ GATGAAAGATCATAGTGATGGGAAAGACTGCGCGGTGAAGCCTGCTGTGATCTGCCACCA
JMFS039F02+ AGTGATGGGAAAGACTGCGCGGTGAAGCCTGCTGTGATCTGCCACCA
                      ____________________________________________________________
consensus GATGAAAGATCATAGTGATGGGAAAGACTGCGCGGTGAAGCCTGCTGTGATCTGCCACCA
 
. : . : . : . : . : . :
JMFS122B02+ GGAGGAGGAAAGGAAGTGAAAGATGATTTTTGTAACAATATTGGTTCACTAGAGCAGTGT
JMFS139F10+ GGAGGAGGAAAGGAAGTGAAAGATGATTTTTGTAACAATATTGGTTCACTAGAGCAGTGT
JMFS039F02+ GGAGNAGGAAAGGAAGTGAAAGATGATTTTTGTAACAATATTGGTTCACTAGAGCAGTGT
                      ____________________________________________________________
consensus GGAGGAGGAAAGGAAGTGAAAGATGATTTTTGTAACAATATTGGTTCACTAGAGCAGTGT
 
. : . : . : . : . : . :
JMFS122B02+ TGTAGCTGCTGGATCTGTGGCTGATGAGGGTAAGAAGACGTTCGGTATAGTGGTTTAGAC
JMFS139F10+ TGTAGCTGCTGGATCTGTGGCTGATGAGGGTAAGAAGACGTTCGGTATAGTGGTTTAGAC
JMFS039F02+ TGTAGCTGCTGGATCTGTGGCTGATGAGGGTAAGAAGACGTTCGGTATAGTGGTTTAGAC
                      ____________________________________________________________
consensus TGTAGCTGCTGGATCTGTGGCTGATGAGGGTAAGAAGACGTTCGGTATAGTGGTTTAGAC
 
. : . : . : . : . : . :
JMFS122B02+ TCTGCAAGATGTACTGAATTGAGGTGTGGCTGAGAAGACCATTTTTTGTTTTCCTGGTAG
JMFS139F10+ TCTGCAAGATGTACTGAATTGAGGTGTGGCTGAGAAGACCATTTTTTGTTTTCCTGGTAG
JMFS039F02+ TCTGCAAGATGTACTGAATTGAGGTGTGGCTGAGAAGACCATTTTTTGTTTTCCTGGTAG
JMFS119A05+ TGGTAG
                      ____________________________________________________________
consensus TCTGCAAGATGTACTGAATTGAGGTGTGGCTGAGAAGACCATTTTTTGTTTTCCTGGTAG
 
. : . : . : . : . : . :
JMFS122B02+ CATTCACTATCAGATAAATGCTGATCAAACCATTCATT-AAAATCTGCATCTCTTGCCCA
JMFS139F10+ CATTCACTATCAGATAAATGCTGATCAAACCATTCATT-AAAATCTGCATCTCTTGCCCA
JMFS039F02+ CATTCACTATCAGATAAATGCTGATCAAACCATTCATT-AAAATCTGCATCTCTTGCCCA
JMFS118D07+ AATGCTGATCAAACCATTCATTAAAAATCTGCATCTCTTGCCCA
JMFS092B10+ TCAAACCATTCATT-AAAATCTGCATCTCTTGCCCA
JMFS119A05+ CATTCACTATCAGATAAATGCTGATCAAACCATTCATT-ANAATCTGCATCTCTTGCCCA
                      ____________________________________________________________
consensus CATTCACTATCAGATAAATGCTGATCAAACCATTCATT-AAAATCTGCATCTCTTGCCCA
 
. : . : . : . : . : . :
JMFS122B02+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAAGATCCTGATCCACGATCGCCAATAACTCC
JMFS139F10+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAAGATCCTGATCCACGATCGCCAATAACTCC
JMFS039F02+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAAGATCCTGATCCACGATCGCCAATAACTCC
JMFS118D07+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAGGATCCTGATCCACGATCGCCAATAACTCC
JMFS092B10+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAGGATCCTGATCCACGATCGCCAATAACTCC
JMFS123C03+ GATCGCCAATAACTCC
JMFS119A05+ TTCAGCTGCAGATGAACTTTCCCTAGAAAAGGATCCTGATCCACGATCGCCAATAACTCC
                      ____________________________________________________________
consensus TTCAGCTGCAGATGAACTTTCCCTAGAAAAGGATCCTGATCCACGATCGCCAATAACTCC
 
. : . : . : . : . : . :
JMFS122B02+ AGGATGTCTCGGGCCAGTGACAACTCTGTTCAACTTTGAA
JMFS139F10+ AGGATGTCTCGGGCCAGTGACAACTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
JMFS039F02+ AGGATGTCTCGGGCCAGTGACAACTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
JMFS118D07+ AGGATGTCTTGGGCCCATGACATTTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
JMFS092B10+ AGGATGTCTTGGGCCCATGACATTTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
JMFS123C03+ AGGATGT-TTGGGCCCATGACATTTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
JMFS119A05+ AGGATGTCTTGGGCCCATGACATTTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
                      ____________________________________________________________
consensus AGGATGTCTTGGGCCCATGACATTTCTGTTCAACTTTGAAAATGTAGTTGCTAGGTCATC
 
. : . : . : . : . : . :
JMFS139F10+ TATATCAGATAATGAACCTAATGTTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
JMFS039F02+ TATATCAGATAATGAACCTAATGTTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
JMFS118D07+ TAAATCAGATAATGAACCTAACATTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
JMFS092B10+ TAAATCAGATAATGAACCTAACATTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
JMFS123C03+ TAAATCAGATAATGAACCTAACATTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
JMFS119A05+ TAAATCAGATAATGAACCTAACATTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
                      ____________________________________________________________
consensus TAAATCAGATAATGAACCTAACATTGATCCCTCATCTTTCTCAAACAAATGATACTCCTG
 
. : . : . : . : . : . :
JMFS139F10+ TATATCTTCATCGCCAAGCCTGCCACCAACTACTCCACCATCAGCAGGTAC
JMFS039F02+ TATATCTTCATCGCCAAGCCTGCCACCAACTACTCCACCATCAGCAGGTAC------ACT
JMFS118D07+ TATATCGTCATCGCCAAGTCCGCCACCGACTCCTCCAGCACCAGCAGGTACACTACTACT
JMFS092B10+ TATATCGTCATCGCCAAGTCCGCCACCGACTCCTCCAGCACCAGCAGGTACACTACTACT
JMFS123C03+ TATATCGTCATCGCCAAGTCCGCCACCGACTCCTCCAGCACCAGCAGGTACACTACTACT
JMFS119A05+ TATATCGTCATCGCCAAGTCCGCCACCGACTCCTCCAGCACCAGCAGGTACACTACTACT
                      ____________________________________________________________
consensus TATATCGTCATCGCCAAGTCCGCCACCGACTCCTCCAGCACCAGCAGGTACACTACTACT
 
. : . : . : . : . : . :
JMFS039F02+ ATCTTCTTCATCTTCTAAACCACCTAACTCGACTTCCTCCAGAACATTTCGCCCAAAAAA
JMFS118D07+ ATCTTCCTCATCCTCTAAACCCCCTAATTCAACTTCCTCAAGAACATTTCGCCCAAAAAA
JMFS092B10+ ATCTTCCTCATCCTCTAAACCCCCTAATTCAACTTCCTCAAGAACATTTCGCCCAAAAAA
JMFS123C03+ ATCTTCCTCATCCTCTAAACCCCCTAATTCAACTTCCTCAAGAACATTTCGCCCAAAAAA
JMFS119A05+ ATCTTCCTCATCCTCTAAACCCCCTAATTCAACTTCCTCAAGAACATTTCGCCCAAAAAA
                      ____________________________________________________________
consensus ATCTTCCTCATCCTCTAAACCCCCTAATTCAACTTCCTCAAGAACATTTCGCCCAAAAAA
 
. : . : . : . : . : . :
JMFS039F02+ CGCGTACTGGGATGCATCGAACATTGCACTATC
JMFS118D07+ CGCGTACTGGGAGGCATCGAACAGTGCACTATCAGAGACGGAGCTAGAGGAGCTGGTGAA
JMFS092B10+ CGCGTACTGGGAGGCATCGAACAGTGCACTATCAGAGACGGAGCTAGAGGAGCTGGTGAA
JMFS123C03+ CGCGTACTGGGAGGCATCGAACAGTGCACTATCAGAGACGGAGCTAGAGGAGCTGGTGAA
JMFS119A05+ CGCGTACTGGGAGGCATCGAACAGTGCACTATCAGAGACGGAGCTAGAGGAGCTGGTGAA
                      ____________________________________________________________
consensus CGCGTACTGGGAGGCATCGAACAGTGCACTATCAGAGACGGAGCTAGAGGAGCTGGTGAA
 
. : . : . : . : . : . :
JMFS118D07+ GTCCTTGAGATCCTTCCCGCTGGATCTCTCCATAATTACAACA
JMFS092B10+ GTCCTTGAGATCCTTCCCGCTGGATCTCTCCATAATTACAACA
JMFS123C03+ GTCCTTGAGATCCTTCCCGCTGGATCTCTCCATAATTACAACA
JMFS119A05+ GTCCTTGAGATCCTTCCCGCTGGATCTCTCCATAATTACAACAAAACAAAAAACGAAGAA
                      ____________________________________________________________
consensus GTCCTTGAGATCCTTCCCGCTGGATCTCTCCATAATTACAACAAAACAAAAAACGAAGAA
 
. : . : . : . : . : . :
JMFS119A05+ AATCAGCAACGCTAGCACCAGCCGCGCCTAGGCATATGAAGAACGGGAGAAGTGAACCAT
                      ____________________________________________________________
consensus AATCAGCAACGCTAGCACCAGCCGCGCCTAGGCATATGAAGAACGGGAGAAGTGAACCAT
 
. : . : . : . : . : . :
JMFS119A05+ TGAAGCGAATCTTAAAACTCCTTCTCGGCAGAAGTGAGGATTCTAGGGTTTTCCAGGGCA
                      ____________________________________________________________
consensus TGAAGCGAATCTTAAAACTCCTTCTCGGCAGAAGTGAGGATTCTAGGGTTTTCCAGGGCA