Previous Contig 003844:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS030B09Sequence549003844 (2)pir|B96695|B966952e-07hypothetical protein F5A8.4 [imported] - Arabidopsis thaliana>gb:AE005173_894334
JMFS118H11Sequence627003844 (2)pir|B96695|B966953e-23hypothetical protein F5A8.4 [imported] - Arabidopsis thaliana>gb:AE005173_894334

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS030B09+ CACTTTTTGTAGAGAGATCTACATTGTTATCATCTTCATC
                      ____________________________________________________________
consensus CACTTTTTGTAGAGAGATCTACATTGTTATCATCTTCATC
 
. : . : . : . : . : . :
JMFS030B09+ CATGAGGTCGGTACCTTCGGATGGATCCAAATCACCATCATTTTCAGGACCTCGATCTGG
                      ____________________________________________________________
consensus CATGAGGTCGGTACCTTCGGATGGATCCAAATCACCATCATTTTCAGGACCTCGATCTGG
 
. : . : . : . : . : . :
JMFS030B09+ CTCGTCAAGCTTCAACCCTGTAGGATCTGTACATGCATCCTGTTCTTCTAAATCCATGTC
                      ____________________________________________________________
consensus CTCGTCAAGCTTCAACCCTGTAGGATCTGTACATGCATCCTGTTCTTCTAAATCCATGTC
 
. : . : . : . : . : . :
JMFS030B09+ TTCCATTTCACTGAGGCTTTCTTCATTCCCATTTTCATCAGGTTGTTTTCCAAGTGCCCC
                      ____________________________________________________________
consensus TTCCATTTCACTGAGGCTTTCTTCATTCCCATTTTCATCAGGTTGTTTTCCAAGTGCCCC
 
. : . : . : . : . : . :
JMFS030B09+ AGGATCAGCGCCTTCCTTTTCATCATCAATAGCAGCAGAGTCATCTTTAGCTTGGAGTTC
JMFS118H11+ CAGCAGAGTCATCTTTAGCTTGGAGTTC
                      ____________________________________________________________
consensus AGGATCAGCGCCTTCCTTTTCATCATCAATAGCAGCAGAGTCATCTTTAGCTTGGAGTTC
 
. : . : . : . : . : . :
JMFS030B09+ CCGTTCATCTCCTTTATCTTTTACTGCTTGGCCTGGCTCATACTTCTCATCTCCGCCATC
JMFS118H11+ CCGTTCATCTCCTTTATCTTNTACTGCTTGGCCTGGCTCATACTTCTCATCTCCGCCATC
                      ____________________________________________________________
consensus CCGTTCATCTCCTTTATCTTTTACTGCTTGGCCTGGCTCATACTTCTCATCTCCGCCATC
 
. : . : . : . : . : . :
JMFS030B09+ ATTATTTTCGTCGTCCTCCCTGTCCCAAAGTTTTTCATCAACTTTTTCACTGTGATCACC
JMFS118H11+ ATTATTTTCGTCGTCCTCCCTGTCCCAAAGTTTTTCATCAACTTTTTCACTGTGATCACC
                      ____________________________________________________________
consensus ATTATTTTCGTCGTCCTCCCTGTCCCAAAGTTTTTCATCAACTTTTTCACTGTGATCACC
 
. : . : . : . : . : . :
JMFS030B09+ AGTTTCCCCAATAGCAGATTCTACTTGCTCATTCTCTTCATTGCCATCTCCATCATCAAC
JMFS118H11+ AGTTTCCCCAATAGCAGATTCTACTTGCTCATTCTCTTCATTGCCATCTCCATCATCAAC
                      ____________________________________________________________
consensus AGTTTCCCCAATAGCAGATTCTACTTGCTCATTCTCTTCATTGCCATCTCCATCATCAAC
 
. : . : . : . : . : . :
JMFS030B09+ AGAATCTTCGCTGACGCTGTATGCATCAGNCTGCAAAATCTTCTTCCATCTCAATGCCCT
JMFS118H11+ AGAATCTTCGCTGACGCTGTATGCATCAG-CTGCAAAATCTTCTTCCATCTCAATGCCCT
                      ____________________________________________________________
consensus AGAATCTTCGCTGACGCTGTATGCATCAGNCTGCAAAATCTTCTTCCATCTCAATGCCCT
 
. : . : . : . : . : . :
JMFS030B09+ TATCTTTTACATTTGACATGTCACCTAAA
JMFS118H11+ TATCTTTTACATTTGACATGTCACCTAAAGAATTCTGTTCATTTGGTTCTTTAGAAGGTT
                      ____________________________________________________________
consensus TATCTTTTACATTTGACATGTCACCTAAAGAATTCTGTTCATTTGGTTCTTTAGAAGGTT
 
. : . : . : . : . : . :
JMFS118H11+ CAAGAAGTTGATCTTCATCAGTTATCTGATCACTAACATCATTACATCCAGTGCCATCAC
                      ____________________________________________________________
consensus CAAGAAGTTGATCTTCATCAGTTATCTGATCACTAACATCATTACATCCAGTGCCATCAC
 
. : . : . : . : . : . :
JMFS118H11+ CCATACCCGTACCACTTGCATCCTGAGTTTCATCCTGGCTGGACTCATTGATTTGGTCTT
                      ____________________________________________________________
consensus CCATACCCGTACCACTTGCATCCTGAGTTTCATCCTGGCTGGACTCATTGATTTGGTCTT
 
. : . : . : . : . : . :
JMFS118H11+ CTTTAGTGCCAAATCCCTTGGAAAATAGTAAAACAAAAACCTCTGCGAGAACATGGGTCA
                      ____________________________________________________________
consensus CTTTAGTGCCAAATCCCTTGGAAAATAGTAAAACAAAAACCTCTGCGAGAACATGGGTCA
 
. : . : . : . : . : . :
JMFS118H11+ TCAAACATACCATCCTGTGCATGACCAGAAAATGGTGCAGAAGACCTTCCCCAAAAGCCA
                      ____________________________________________________________
consensus TCAAACATACCATCCTGTGCATGACCAGAAAATGGTGCAGAAGACCTTCCCCAAAAGCCA
 
. : . : . : . : . : . :
JMFS118H11+ GGATAGCATTTGACAAGGAATAAAGATGTTTCAGATGTGTTTTGATGAGAGAAGATAAGT
                      ____________________________________________________________
consensus GGATAGCATTTGACAAGGAATAAAGATGTTTCAGATGTGTTTTGATGAGAGAAGATAAGT