Previous Contig 003842:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS115A10Sequence627003842 (2)gb:AC126222_1740521e-100Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0014I10, complet
JMFS118E08Sequence625003842 (2)gb:AC126222_17405216e-94Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0014I10, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS115A10+ CCAAGCCATTGCCAAGACATCATCATATACAGGT
                      ____________________________________________________________
consensus CCAAGCCATTGCCAAGACATCATCATATACAGGT
 
. : . : . : . : . : . :
JMFS115A10+ CCAACACGATAGCCTTTGCCCTTACTCCGAGCCAAACTTCCCCAGACTGTTGACAAACCA
JMFS118E08+ AACTTCCCCAGACTG-TGACAAACCA
                      ____________________________________________________________
consensus CCAACACGATAGCCTTTGCCCTTACTCCGAGCCAAACTTCCCCAGACTGTTGACAAACCA
 
. : . : . : . : . : . :
JMFS115A10+ GGATAAACTGGTGGTTGGCGATCATCAAAATCGTCAAAAGCATAGTCTACGTAGTTCACT
JMFS118E08+ GGATAAACTGGTGGTTGGCGATCATCAAAATCGTCAAAAGCATAGTCTACGTAGTTCACT
                      ____________________________________________________________
consensus GGATAAACTGGTGGTTGGCGATCATCAAAATCGTCAAAAGCATAGTCTACGTAGTTCACT
 
. : . : . : . : . : . :
JMFS115A10+ AGGAAAACATTTCTTTCAGCTTCATCAACTGACTCTTGCTGTACCCTTGTTAAAATGTTA
JMFS118E08+ AGGAAAACATTTCTTTCAGCTTCATCAACTGACTCTTGCTGTACCCTTGTTAAAATGTTA
                      ____________________________________________________________
consensus AGGAAAACATTTCTTTCAGCTTCATCAACTGACTCTTGCTGTACCCTTGTTAAAATGTTA
 
. : . : . : . : . : . :
JMFS115A10+ ACCATGGCTCTGAAGGCTGCAACCTGAAGGGTTTCTCCACCATTGCTTATGAGATGAAGA
JMFS118E08+ ACCATGGCTCTGAAGGCTGCAACCTGAAGGGTTTCTCCACCATTGCTTATGAGATGAAGA
                      ____________________________________________________________
consensus ACCATGGCTCTGAAGGCTGCAACCTGAAGGGTTTCTCCACCATTGCTTATGAGATGAAGA
 
. : . : . : . : . : . :
JMFS115A10+ AGCATATTTAAAATTGGATACAGAAATTGAAGCAAAGCTGTAGAATCAACATTCTTCAAA
JMFS118E08+ AGCATATTTAAAATTGGATACAGAAATTGAAGCAAAGCTGTAGAATCAACATTCTTCAAA
                      ____________________________________________________________
consensus AGCATATTTAAAATTGGATACAGAAATTGAAGCAAAGCTGTAGAATCAACATTCTTCAAA
 
. : . : . : . : . : . :
JMFS115A10+ CTGTTAATGGCCTCAAGAAGCTCAGATCCCCACGGTGGACTTGTTCGAAGAGTGTGTCTG
JMFS118E08+ CTGTTAATGGCCTCAAGAAGCTCAGATCCCCACGGTGGACTTGTTCGAAGAGTGTGTCTG
                      ____________________________________________________________
consensus CTGTTAATGGCCTCAAGAAGCTCAGATCCCCACGGTGGACTTGTTCGAAGAGTGTGTCTG
 
. : . : . : . : . : . :
JMFS115A10+ TCATATTCAAGGAAAAGATCCCTAATTCGTTCACTGATAGGGTATAAAGAGGAACATAGT
JMFS118E08+ TCATATTCAAGGAAAAGATCCCTAATTCGTTCACTGATAGGGTATAAAGAGGAACATAGT
                      ____________________________________________________________
consensus TCATATTCAAGGAAAAGATCCCTAATTCGTTCACTGATAGGGTATAAAGAGGAACATAGT
 
. : . : . : . : . : . :
JMFS115A10+ CGTAAGCGGAGCTTGAAAATACTCTTGCCATCCTCTATGTAATCCAACCTCTCCTTGCCA
JMFS118E08+ CGTAAGCGGAGCTTGAAAATACTCTTGCCATCCTCTATGTAATCCAACCTCTCCTTGCCA
                      ____________________________________________________________
consensus CGTAAGCGGAGCTTGAAAATACTCTTGCCATCCTCTATGTAATCCAACCTCTCCTTGCCA
 
. : . : . : . : . : . :
JMFS115A10+ CTGTCTTGGAGATAATGAGGAACTAACTCCTTCATAACCGGTAAGGAGATCTCAGATTTG
JMFS118E08+ CTGTCTTGGAGATAATGAGGAACTAACTCCTTCATAACCGGTAAGGAGATCTCAGATTTG
                      ____________________________________________________________
consensus CTGTCTTGGAGATAATGAGGAACTAACTCCTTCATAACCGGTAAGGAGATCTCAGATTTG
 
. : . : . : . : . : . :
JMFS115A10+ AGCTGAGCATGAGTGGATAGTGGAAGTGATGCATATCCAACTACTACTGGCTT
JMFS118E08+ AGCTGAGCATGAGTGGATAGTGGAAGTGATGCATATCCAACTACTACTGGCTTTGGAGCT
                      ____________________________________________________________
consensus AGCTGAGCATGAGTGGATAGTGGAAGTGATGCATATCCAACTACTACTGGCTTTGGAGCT
 
. : . : . : . : . : . :
JMFS118E08+ TCAAGCTTTGTTTGAAGGTCAACATGATAAAATGTAAACAAAAGGTGATGCATTGGTGTC
                      ____________________________________________________________
consensus TCAAGCTTTGTTTGAAGGTCAACATGATAAAATGTAAACAAAAGGTGATGCATTGGTGTC