Previous Contig 003840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS092A05Sequence623003840 (2)gb:AY830138_16293404e-73Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMFS118C08Sequence612003840 (2)gb:AY830138_16293406e-64Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS092A05+ ATATAATCCAGACCTTCA
                      ____________________________________________________________
consensus ATATAATCCAGACCTTCA
 
. : . : . : . : . : . :
JMFS092A05+ AACCATTGTGCTACAGATATGTATCTCAAGAAAATGAAATCCCCAAAATGCATTTGCATT
                      ____________________________________________________________
consensus AACCATTGTGCTACAGATATGTATCTCAAGAAAATGAAATCCCCAAAATGCATTTGCATT
 
. : . : . : . : . : . :
JMFS092A05+ CTTCGGAAGAATGGAGGTGGAACAGAAGCTAAAACTCTTAACAGCTTGAGAGGTACAGAA
                      ____________________________________________________________
consensus CTTCGGAAGAATGGAGGTGGAACAGAAGCTAAAACTCTTAACAGCTTGAGAGGTACAGAA
 
. : . : . : . : . : . :
JMFS092A05+ ATTTCAGGATTTTCATGAAAGAAGAAAATGGAGCGAGAGTTAATTGTATCAAACAACACA
                      ____________________________________________________________
consensus ATTTCAGGATTTTCATGAAAGAAGAAAATGGAGCGAGAGTTAATTGTATCAAACAACACA
 
. : . : . : . : . : . :
JMFS092A05+ TAATAGTCAAAACTATGTGTGTATAAACTCAACCAACGGCATGAATTTGCAAATGCATTT
JMFS118C08+ GCAAATGCATTT
                      ____________________________________________________________
consensus TAATAGTCAAAACTATGTGTGTATAAACTCAACCAACGGCATGAATTTGCAAATGCATTT
 
. : . : . : . : . : . :
JMFS092A05+ AATGAAACTCCTGGAAATTGCATAATATTTACTGCACATAAAATACCTCCTTTTTGAGCT
JMFS118C08+ AATGAAACTCCTGGAAATTGCATAATATTTACTGCACATAAAATACCTCCTTTNTGAGCT
                      ____________________________________________________________
consensus AATGAAACTCCTGGAAATTGCATAATATTTACTGCACATAAAATACCTCCTTTTTGAGCT
 
. : . : . : . : . : . :
JMFS092A05+ TCTCCTACACAGAAAGTATGCATGTTACCATGCATCTTACAAGTCTTAATTTTGCCATTT
JMFS118C08+ TCTCCTACACAGAAAGTATGCATGTTACCATGCATCTTACAAGTCTTAATTTTGCCATTT
                      ____________________________________________________________
consensus TCTCCTACACAGAAAGTATGCATGTTACCATGCATCTTACAAGTCTTAATTTTGCCATTT
 
. : . : . : . : . : . :
JMFS092A05+ GAGCCCCGGCTACTAATTAAGATAAGACTTCTATCAACAAGCTCTTGTAAATACTCATAA
JMFS118C08+ GAGCCCCGGCTACTAATTAAGATAAGACTTCTATCAACAAGCTCTTGTAAATACTCATAA
                      ____________________________________________________________
consensus GAGCCCCGGCTACTAATTAAGATAAGACTTCTATCAACAAGCTCTTGTAAATACTCATAA
 
. : . : . : . : . : . :
JMFS092A05+ GCTACATTTTCCAACTCTTTATGCTCCAATAGCTCCACAAATCCCTCAGCAACCCACAAT
JMFS118C08+ GCTACATTTTCCAACTCTTTATGCTCCAACAGCTCCACAAATCCCTCAGCAACCCACAAT
                      ____________________________________________________________
consensus GCTACATTTTCCAACTCTTTATGCTCCAATAGCTCCACAAATCCCTCAGCAACCCACAAT
 
. : . : . : . : . : . :
JMFS092A05+ CTAATAAGCGTTTTAACTGAGATTTCACTGCGTTTTGGGAAGACTCCAAAATATAGAAAG
JMFS118C08+ CTAATAAGCGTTTTAACTGAGATTTCACTGCGTTTTGGGAAGACTCCAAAATATAGAAAG
                      ____________________________________________________________
consensus CTAATAAGCGTTTTAACTGAGATTTCACTGCGTTTTGGGAAGACTCCAAAATATAGAAAG
 
. : . : . : . : . : . :
JMFS092A05+ CAAACATTCACATATTTTGGCAATTGATTGTATATGCGAGCAAGTACACTTCGATCTAGA
JMFS118C08+ CAAACATTCACATATTTTGGCAATTGATTGTATATGCGAGCAAGTACACTTCGATCTAGA
                      ____________________________________________________________
consensus CAAACATTCACATATTTTGGCAATTGATTGTATATGCGAGCAAGTACACTTCGATCTAGA
 
. : . : . : . : . : . :
JMFS092A05+ ACTCC
JMFS118C08+ ACTCCCAGCAACTCTAATTCCTTTTCAATCTTCTTCCATTCTTGTTGTATGTTGTTGCAT
                      ____________________________________________________________
consensus ACTCCCAGCAACTCTAATTCCTTTTCAATCTTCTTCCATTCTTGTTGTATGTTGTTGCAT
 
. : . : . : . : . : . :
JMFS118C08+ TTTGATAAACGCTTTGCAACTTCAACAATTAATTGTGGTAATCCTTCACATTTCTCCAAA
                      ____________________________________________________________
consensus TTTGATAAACGCTTTGCAACTTCAACAATTAATTGTGGTAATCCTTCACATTTCTCCAAA
 
. : . : . : . : . : . :
JMFS118C08+ ACCTCACTCCTAATTTTTTCAAATTTAGGTGCCATAGATTCTTTGGGAGAAAGGATATTG
                      ____________________________________________________________
consensus ACCTCACTCCTAATTTTTTCAAATTTAGGTGCCATAGATTCTTTGGGAGAAAGGATATTG
 
. : . : . : . : . : . :
JMFS118C08+ CAGAATAGATCCCAACTTTCATTTGGATCCAGAAAAGCCATTTTACGCTTATAAAACTTT
                      ____________________________________________________________
consensus CAGAATAGATCCCAACTTTCATTTGGATCCAGAAAAGCCATTTTACGCTTATAAAACTTT