Previous Contig 003836:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS050E07Sequence586003836 (3)pir|T01367|T013672e-08hypothetical protein At2g34680 [imported] - Arabidopsis thaliana>gb:AC003096_153
JMFS117H07Sequence574003836 (3)
JMSF036E19Sequence700003836 (3)pir|T01367|T013676e-11hypothetical protein At2g34680 [imported] - Arabidopsis thaliana>gb:AC003096_153341012972 (3)gb:AY063958_15659031e-21Arabidopsis thaliana putative ADP-ribosylation factor (At3g22950) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036E19+ TNTTAGCAGAGTCATACTTGG
                      ____________________________________________________________
consensus TNTTAGCAGAGTCATACTTGG
 
. : . : . : . : . : . :
JMFS050E07+ CTGACTTTC
JMSF036E19+ ATGTATCAGAACGAGATGATGCTTTTGGAGTCGCAGCAGGAGATGAAGGAACTGACTTTC
                      ____________________________________________________________
consensus ATGTATCAGAACGAGATGATGCTTTTGGAGTCGCAGCAGGAGATGAAGGAACTGACTTTC
 
. : . : . : . : . : . :
JMFS050E07+ TAGTTTCTGAAATAGTTGATCGAGTAAGGGATCTGCCATTAGTTGATGGCAGTGAACTCC
JMSF036E19+ TAGTTTCTGAAATAGNTGATCGAGTAAGGGATCTGCCATTAGCTGATGGCAGTGAACTCC
                      ____________________________________________________________
consensus TAGTTTCTGAAATAGTTGATCGAGTAAGGGATCTGCCATTAGTTGATGGCAGTGAACTCC
 
. : . : . : . : . : . :
JMFS050E07+ GTCTAATTTCAGGAAGTGATCTCCTCACAGGATCTGGGGCAGAGGAGGTAGGCTTTTTTG
JMSF036E19+ GTNTAATTTCAGGAAGTGATCTCCTCACAGGATCTGGGGCAGAGGAGGTAGGCTTTTTTG
JMFS117H07+ ACAGGATCTGGGGCAGAGGAGGTAGGCTTTTTTG
                      ____________________________________________________________
consensus GTCTAATTTCAGGAAGTGATCTCCTCACAGGATCTGGGGCAGAGGAGGTAGGCTTTTTTG
 
. : . : . : . : . : . :
JMFS050E07+ CCACAACAGAATTTACATTAGTAGACCTCTTAGTAACTGTTGGCTGTTTATCAGGCAAAC
JMSF036E19+ CCACAACAGAATTTACANTAGTAGACCTCTTAGTAACTGTTGGCTGTTTATCAGGCAAAC
JMFS117H07+ CCACAACAGAATTTACATTAGTAGACCTCTTAGTAACTGTTGGCTGTTTATCAGGCAAAC
                      ____________________________________________________________
consensus CCACAACAGAATTTACATTAGTAGACCTCTTAGTAACTGTTGGCTGTTTATCAGGCAAAC
 
. : . : . : . : . : . :
JMFS050E07+ CACCGGTGCTGTTTCTTCTGGCAACTGGGACTCCAGTAGAACTCCTTGAAGCACTACTAA
JMSF036E19+ CACCGGTGCTGTTTCTTCTGGCAACTGGGACTCCAGTAGAACTCCTTGAAGCACTANTAA
JMFS117H07+ CACCGGTGCTGTTTCTTCTGGCAACTGGGACTCCAGTAGAACTCCTTGAAGCACTACTAA
                      ____________________________________________________________
consensus CACCGGTGCTGTTTCTTCTGGCAACTGGGACTCCAGTAGAACTCCTTGAAGCACTACTAA
 
. : . : . : . : . : . :
JMFS050E07+ GGGTAGGTTTTGTCAATGTTGATGACTTGAACCCACTGGAATTAGTATCAGCTCCATTCA
JMSF036E19+ GGGTAGGTTTTGTCAATGTTGATGACTTGAACCCACTGGAATTAGTATCAGCTCCATTCA
JMFS117H07+ GGGTAGGTTTTGTCAATGTTGATGACTTGAACCCACTGGAATTAGTATCAGCTCCATTCA
                      ____________________________________________________________
consensus GGGTAGGTTTTGTCAATGTTGATGACTTGAACCCACTGGAATTAGTATCAGCTCCATTCA
 
. : . : . : . : . : . :
JMFS050E07+ TTGATTCCGCTTTCTTCGCTAACCCAGCATTCTTCATCCTAGAGCTCTGTTTCACATTCT
JMSF036E19+ TTGATTCCGCTTTCTTCGCTAACCCAGCATTCTTCATCCTAGAGCTCTGTTTCACATTCT
JMFS117H07+ TTGATTCCGCTTTCTTCGCTAACCCAGCATTCTTCATCCTAGAGCTCTGTTTCACATTCT
                      ____________________________________________________________
consensus TTGATTCCGCTTTCTTCGCTAACCCAGCATTCTTCATCCTAGAGCTCTGTTTCACATTCT
 
. : . : . : . : . : . :
JMFS050E07+ TAGTTGTTTTCACATCCTCAGCAGATGATTGCTTCTGCGACTTTTCCACATCATCCTCAA
JMSF036E19+ TAGTTGTTTTCACATCCTCAGCAGATGATTGCTTNTGCGACTTTTCCACATCATCCTCAA
JMFS117H07+ TAGTTGTTTTCACATCCTCAGCAGATGATTGCTTCTGCGACTTTTCCACATCATCCTCAA
                      ____________________________________________________________
consensus TAGTTGTTTTCACATCCTCAGCAGATGATTGCTTCTGCGACTTTTCCACATCATCCTCAA
 
. : . : . : . : . : . :
JMFS050E07+ CCACAGTTGGCTTCTCTAATTCTGGACTTTGTGCCTCTTCCACAGCATCCTCCGTGTACC
JMSF036E19+ CCACAGTTGGCTTCTCTAATTCTGGACTTTGTGCNTCTTCCACAGCATCCTCCGTGTACC
JMFS117H07+ CCACAGTTGGCTTCTCTAATTCTGGACTTTGTGCCTCTTCCACAGCATCCTCCGTGTACC
                      ____________________________________________________________
consensus CCACAGTTGGCTTCTCTAATTCTGGACTTTGTGCCTCTTCCACAGCATCCTCCGTGTACC
 
. : . : . : . : . : . :
JMFS050E07+ TTGGAATTGAACCATCCATTCTGACGTTTCAACTATGAAGAGAACAACCTAGTAGTAACT
JMSF036E19+ TTGGAATTGAACCATCCATTCTGACGTTTCAACTATGAAGAGAACAACCTAGTAGTAACT
JMFS117H07+ TTGGAATTGAACCATCCATTCTGACGTTTCAACTATGAAGAGAACAACCTAGTAGTAACT
                      ____________________________________________________________
consensus TTGGAATTGAACCATCCATTCTGACGTTTCAACTATGAAGAGAACAACCTAGTAGTAACT
 
. : . : . : . : . : . :
JMFS050E07+ GTGTTTTCCTTAGGGTTTTGCAAAAGGAGAAATGCTT
JMSF036E19+ GTGTTTTCCTTAGGGTTTTGCAAAAGGAGAAATGCTTTGGAACAGAGAATCCANGGAGAG
JMFS117H07+ GTGTTTTCCTTAGGGTTTTGCAAAAGGAGAAATGCTTTGGAACAGAGAATCCATGGAGAG
                      ____________________________________________________________
consensus GTGTTTTCCTTAGGGTTTTGCAAAAGGAGAAATGCTTTGGAACAGAGAATCCATGGAGAG
 
. : . : . : . : . : . :
JMSF036E19+ AGAGAGAGAGAGCGC
JMFS117H07+ AGAGAGAGAGAGCGCTCTGAGTGAAAGCGTGAGGAGAAAAGGCTAAAAAGAGAGAGTGAG
                      ____________________________________________________________
consensus AGAGAGAGAGAGCGCTCTGAGTGAAAGCGTGAGGAGAAAAGGCTAAAAAGAGAGAGTGAG