Previous Contig 003834:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012M02Sequence520003834 (8)gb:BT000348_16346265e-35Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513801006226 (23)pir|C96574|C965742e-80hypothetical protein T3F20.25 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMFF019N05Sequence588003834 (8)gb:BT000348_16346263e-41Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513766006226 (23)pir|C96574|C965743e-75hypothetical protein T3F20.25 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMFS105G08Sequence601003834 (8)gb:BT000348_16346263e-41Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMFS117D09Sequence610003834 (8)gb:BT000348_16346261e-41Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMFS123C06Sequence575003834 (8)gb:BT000348_16346262e-40Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMFS141C07Sequence626003834 (8)gb:BT000348_16346261e-40Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMFS167E04Sequence634003834 (8)gb:BT000348_16346262e-43Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMSF027K20Sequence661003834 (8)gb:BT000348_16346268e-44Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513748006226 (23)pir|C96574|C965742e-94hypothetical protein T3F20.25 [imported] - Arabidopsis thaliana>gb:AE005173_8932

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027K20+ TCTATCAGTTCTGTGAGAGCATTAAGTTCTTTTGGCAATTCACCTGTGAGAT
JMFS167E04+ GTGAGAGCATTAAGTTCTTTTGGCAATTCACCTGTGAGAT
JMFS123C06+ AT
JMFF019N05+ TGAGAT
JMFS105G08+ GTGAGAT
JMFS117D09+ CCTGTGAGAT
                      ____________________________________________________________
consensus TCTATCAGTTCTGTGAGAGCATTAAGTTCTTTTGGCAATTCACCTGTGAGAT
 
. : . : . : . : . : . :
JMSF027K20+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
JMFS167E04+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
JMFS123C06+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCNCAAGCTCAGGTGGAACAC
JMFF019N05+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
JMFS141C07+ AAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
JMFS105G08+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
JMFS117D09+ AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
                      ____________________________________________________________
consensus AATTACCACTAAGAAAGAAATGTTGTAAGTTGACAAGTTTCCCAAGCTCAGGTGGAACAC
 
. : . : . : . : . : . :
JMSF027K20+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFS167E04+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFS123C06+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFF019N05+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFS141C07+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFF012M02+ CCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFS105G08+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
JMFS117D09+ TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
                      ____________________________________________________________
consensus TTCCAGTGAACATATTGTTCTCCAAGCTTAAATATGTAAGAGTTGTTATACTTCCCAAGT
 
. : . : . : . : . : . :
JMSF027K20+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFS167E04+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFS123C06+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFF019N05+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFS141C07+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFF012M02+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFS105G08+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
JMFS117D09+ ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
                      ____________________________________________________________
consensus ATTTTGGAATTGGCCCAGACAATCGATTCACAGTAAGAGATATAAGTTCCAGTTTCATAG
 
. : . : . : . : . : . :
JMSF027K20+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFS167E04+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFS123C06+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFF019N05+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFS141C07+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFF012M02+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFS105G08+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
JMFS117D09+ AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
                      ____________________________________________________________
consensus AAGCCCATTCAGGGGGGATTGTACCACTTAAGTAGTTGCGGGTGAGATCAATTGTCTTGA
 
. : . : . : . : . : . :
JMSF027K20+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFS167E04+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFS123C06+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFF019N05+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFS141C07+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGAACACCTTGCAGATCCTGTCCTTTCAAAT
JMFF012M02+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFS105G08+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
JMFS117D09+ GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
                      ____________________________________________________________
consensus GAAAGGGTAACTTCACCAAAGCAGGAGGGAGGACACCTTGCAGATCCTGTCCTTTCAAAT
 
. : . : . : . : . : . :
JMSF027K20+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFS167E04+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFS123C06+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFF019N05+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFS141C07+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFF012M02+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFS105G08+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
JMFS117D09+ TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
                      ____________________________________________________________
consensus TTATCCTTAGCACATGGCAAATACCAGCAGGGAAGTTACAATCGCAAGTGAGATTATTAG
 
. : . : . : . : . : . :
JMSF027K20+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFS167E04+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFS123C06+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFF019N05+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFS141C07+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFF012M02+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFS105G08+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
JMFS117D09+ TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
                      ____________________________________________________________
consensus TGTAGAGAGGTGTATCTATGCTTTGTGGTGCCAACCAGTTGGAGTGGTTGCCGCAAGGAT
 
. : . : . : . : . : . :
JMSF027K20+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFS167E04+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFS123C06+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFF019N05+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFS141C07+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFF012M02+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFS105G08+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
JMFS117D09+ TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
                      ____________________________________________________________
consensus TTAAGCTAAAATCCCAATCCTTCTTCCCCACTTGATTAGCTATTTCCTTAAGTGCATTTA
 
. : . : . : . : . : . :
JMSF027K20+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFS167E04+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFS123C06+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFF019N05+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFS141C07+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFF012M02+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFS105G08+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
JMFS117D09+ ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
                      ____________________________________________________________
consensus ATTCATGTTGAGGAAGATGCCCACTCTGTGCTTCAAGAAATAATGGATAGAAGAAGAAGG
 
. : . : . : . : . : . :
JMSF027K20+ AGAGTATAATTGGTATGAGGATTCTGAACATGG
JMFS167E04+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTT-AACTCCGGGGAAGATCAA
JMFS123C06+ AGAGTATAATTGGTATGAGGATTCTGAACATGG
JMFF019N05+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCC
JMFS141C07+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCCGGGGAAGA
JMFF012M02+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCC
JMFS105G08+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCCGGGGAAGATCAA
JMFS117D09+ AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCCGGGGAAGATCAATGATCA
                      ____________________________________________________________
consensus AGAGTATAATTGGTATGAGGATTCTGAACATGGTTGAACTCCGGGGAAGATCAATGATCA