Previous Contig 003832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021A07Sequence623003832 (3)gb:BT001922_1635525e-100Arabidopsis thaliana clone C104767 unknown protein (At5g15070) mRNA, complete cd
JMFS103F09Sequence547003832 (3)gb:BT001922_16355257e-58Arabidopsis thaliana clone C104767 unknown protein (At5g15070) mRNA, complete cd
JMFS117D06Sequence611003832 (3)gb:BT001922_16355253e-38Arabidopsis thaliana clone C104767 unknown protein (At5g15070) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS021A07+ TGTAGGCATGAATTCCTCGTAAATATAGGACCCCTCGCGTCTGACTCTTC
                      ____________________________________________________________
consensus TGTAGGCATGAATTCCTCGTAAATATAGGACCCCTCGCGTCTGACTCTTC
 
. : . : . : . : . : . :
JMFS021A07+ TAACCTCAGGATGGAATTCACTTGAGCGGTTTCCAACCTTCCGGAACAACTTTTTCATTC
                      ____________________________________________________________
consensus TAACCTCAGGATGGAATTCACTTGAGCGGTTTCCAACCTTCCGGAACAACTTTTTCATTC
 
. : . : . : . : . : . :
JMFS021A07+ CTCCCCCTGCTGAACTAGGGTAGTATATCATTATACTGTGGTCATCAGCATCAACAGGTT
                      ____________________________________________________________
consensus CTCCCCCTGCTGAACTAGGGTAGTATATCATTATACTGTGGTCATCAGCATCAACAGGTT
 
. : . : . : . : . : . :
JMFS021A07+ TCTCCACAAAAGGTTTACAGAAGCGTTTCCCGTGAACTTCAACAAAATCTTCTTCCTCAG
                      ____________________________________________________________
consensus TCTCCACAAAAGGTTTACAGAAGCGTTTCCCGTGAACTTCAACAAAATCTTCTTCCTCAG
 
. : . : . : . : . : . :
JMFS021A07+ CAAAATAATCTAACTCTTGATAGGGTACTTGTCTATTAACACAAGCGTATCTTGGAACTG
JMFS103F09+ AAATAATCCAGCTCTTGATAGCGGACTTCTCTATTAACACAAGCATATCTTGGAACAG
                      ____________________________________________________________
consensus CAAAATAATCTAGCTCTTGATAGGGTACTTGTCTATTAACACAAGCGTATCTTGGAACTG
 
. : . : . : . : . : . :
JMFS021A07+ GAATTCCACACGTCTCAAGACGCTCATACACTTTCCTTCGATCATGAAGAAGATACTGTA
JMFS103F09+ GAATTCCAAACATCTCAAGCCGCTCATAGACTTTCCTCCTATCATGTAGAAGGTGTTGTG
                      ____________________________________________________________
consensus GAATTCCACACGTCTCAAGCCGCTCATAGACTTTCCTTCTATCATGTAGAAGGTGTTGTG
 
. : . : . : . : . : . :
JMFS021A07+ GCTCCAATTCATTTACAAGGAAAGGCTTTCTCAACGCAGCATAGGCTTCAGCCTTCTCCA
JMFS103F09+ GCTCCAGCTCATTTACAAGGAAAGGCTTTCTCCATTTAGCATATGACTCAGCCTTCTTCA
JMFS117D06+ TCATTTACAAGGAAAGGCTTTCTCCATTTAGCATATGACTCAGCCTTCTTCA
                      ____________________________________________________________
consensus GCTCCAGTTCATTTACAAGGAAAGGCTTTCTCCATTTAGCATATGACTCAGCCTTCTTCA
 
. : . : . : . : . : . :
JMFS021A07+ GAGGATAACCAGTAGAATAGAAGGCAATCAAACAATCACAGATTGGCCAGCTCTCAATTG
JMFS103F09+ AAGGATACCCAGAAGAATAGAAAGCAATAAAGCAATCGCATATTGGCCAGCTTTCAATCG
JMFS117D06+ AAGGATACCCAGAAGAATAGAAAGCAATCAAGCAATCGCATATTGGCCAGCTTTCAATCG
                      ____________________________________________________________
consensus AAGGATACCCAGAAGAATAGAAAGCAATCAAGCAATCGCATATTGGCCAGCTTTCAATCG
 
. : . : . : . : . : . :
JMFS021A07+ GATCCCCAAGGATAATGTTGTCACCAAAATGCAGAACCTCAAATTCACCAAATGCCTGTA
JMFS103F09+ GATCCTCAAGGATAACCTTGTCACCAAAATGTACAACCTCAAATTCGCCGAATGACTGTA
JMFS117D06+ GATCCTCAAGGATAACCTTGTCACCAAAATGTACAACCTCAAATTCGCCGAATGACTGTA
                      ____________________________________________________________
consensus GATCCTCAAGGATAACCTTGTCACCAAAATGTACAACCTCAAATTCGCCGAATGACTGTA
 
. : . : . : . : . : . :
JMFS021A07+ ACCTGTCCAGAATCTGCCCCATAGGAGCGGA
JMFS103F09+ ATCTGTCCAGAATCTGCCCCATAGGCGCGGAAAA------------------CACCTTCT
JMFS117D06+ ATCTGTCCAGAATCTGCCCCATAGGCGCGGAAAACACCTCGGAGCCGCATTTCACCTTCT
                      ____________________________________________________________
consensus ATCTGTCCAGAATCTGCCCCATAGGCGCGGAAAACACCTCGGAGCCGCATTTCACCTTCT
 
. : . : . : . : . : . :
JMFS103F09+ TTTCCATTACACATACTCCAATCGTTATCTTCTTCACCACATTATCCTCCGCCTCCATTT
JMFS117D06+ TTTCCATTACACATACTCCAATCGTTATCTTCTTCACCACATTATCCTCCGCCTCCATTT
                      ____________________________________________________________
consensus TTTCCATTACACATACTCCAATCGTTATCTTCTTCACCACATTATCCTCCGCCTCCATTT
 
. : . : . : . : . : . :
JMFS103F09+ CTCCCTCTCTCCCTCTCTGGATATCTAAACCTATGAATATCTATTTATCTATGTATATCT
JMFS117D06+ CTCCCTCTCTCCCTCTCTGGATATCTAAACCTATGAATATCTATTTATCTATGTATATCT
                      ____________________________________________________________
consensus CTCCCTCTCTCCCTCTCTGGATATCTAAACCTATGAATATCTATTTATCTATGTATATCT
 
. : . : . : . : . : . :
JMFS103F09+ CTATCGCCTATACGTATATCGGAATGAGTTGAAACGGCTTTAATTTTCTCCCTCCTTTCC
JMFS117D06+ CTATCGCCTATACGTATATCGGAATGAGTTGAAACGGCTTTAATTTTCTCCCTCCTTTCC
                      ____________________________________________________________
consensus CTATCGCCTATACGTATATCGGAATGAGTTGAAACGGCTTTAATTTTCTCCCTCCTTTCC
 
. : . : . : . : . : . :
JMFS103F09+ GCTCCGCTCAA
JMFS117D06+ GCTCCGCTCAACTGCTCAAAAACACAGAAACAGGTGAGCTTATGCAAAGCGCGTGTGTAT
                      ____________________________________________________________
consensus GCTCCGCTCAACTGCTCAAAAACACAGAAACAGGTGAGCTTATGCAAAGCGCGTGTGTAT
 
. : . : . : . : . : . :
JMFS117D06+ AAATATATATAGGTGTGTATGTGTGTGCGCGCTAAAATGAGAAAGACAAAAAGAAAACGG
                      ____________________________________________________________
consensus AAATATATATAGGTGTGTATGTGTGTGCGCGCTAAAATGAGAAAGACAAAAAGAAAACGG
 
. : . : . : . : . : . :
JMFS117D06+ AAAGAAAATACGACGATATAACACTAGAAATCGTTAACCAGAGATACTGAGATGCACCAA
                      ____________________________________________________________
consensus AAAGAAAATACGACGATATAACACTAGAAATCGTTAACCAGAGATACTGAGATGCACCAA