Previous Contig 003830:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS014G06Sequence620003830 (8)gb:AY099704_15767293e-89Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS026A03Sequence642003830 (8)gb:AY099704_15767296e-98Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS058C09Sequence642003830 (8)gb:AY099704_15767299e-67Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS088E05Sequence684003830 (8)gb:AY099704_15767292e-62Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS092A11Sequence619003830 (8)gb:AY099704_1576729e-101Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS103B09Sequence555003830 (8)gb:AY099704_15767292e-41Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS117C02Sequence625003830 (8)gb:AY099704_15767291e-40Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003
JMFS148B04Sequence605003830 (8)gb:AY099704_15767292e-41Arabidopsis thaliana alpha-mannosidase (At5g13980) mRNA, complete cds.>gb:BT0003

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS092A11+ GAAAT
                      ____________________________________________________________
consensus GAAAT
 
. : . : . : . : . : . :
JMFS092A11+ ATCCTGTCCAGTAAGCATTTTCACGGTCTGCGTATGGGAAATAGTCCTCAGTCTTAAGAG
                      ____________________________________________________________
consensus ATCCTGTCCAGTAAGCATTTTCACGGTCTGCGTATGGGAAATAGTCCTCAGTCTTAAGAG
 
. : . : . : . : . : . :
JMFS092A11+ GCCAAGACTGATCGGAAGCATATTTTGCATCAGTGTAGATCGATGGAGTTGAGTACAAAG
                      ____________________________________________________________
consensus GCCAAGACTGATCGGAAGCATATTTTGCATCAGTGTAGATCGATGGAGTTGAGTACAAAG
 
. : . : . : . : . : . :
JMFS092A11+ CATTCACACGGCCATCTTGATTGACATAATGAATGAGTTTGTCCAGGTTCCGAAACCAAC
                      ____________________________________________________________
consensus CATTCACACGGCCATCTTGATTGACATAATGAATGAGTTTGTCCAGGTTCCGAAACCAAC
 
. : . : . : . : . : . :
JMFS092A11+ TGTGTGCATACTGGTACTTGAAATCCGTTCCCATGGTCCACATTACATGATTCGTGCGGG
JMFS026A03+ TCCGTTCCCATGGTCCACATTACATGATTCGTGCGGG
                      ____________________________________________________________
consensus TGTGTGCATACTGGTACTTGAAATCCGTTCCCATGGTCCACATTACATGATTCGTGCGGG
 
. : . : . : . : . : . :
JMFS092A11+ TAATATTAGCCTGCGACAATGCAGCAGCTACAAAGTCATTGACACGCTCTGGGACATTGT
JMFS026A03+ TAATATTAGCCTGCGACAATGCAGCAGCTACAAAGTCATTGACACGCTCTGGGACATTGT
                      ____________________________________________________________
consensus TAATATTAGCCTGCGACAATGCAGCAGCTACAAAGTCATTGACACGCTCTGGGACATTGT
 
. : . : . : . : . : . :
JMFS092A11+ AATCAAACAGATCGGTATCGTCCTGAACAACGGGAGAATCGTCGTTGACTTCAAAATAGA
JMFS026A03+ AATCAAACAGATCGGTATCGTCCTGAACAACGGGAGAATCGTCGTTGACTTCAAAATAGA
                      ____________________________________________________________
consensus AATCAAACAGATCGGTATCGTCCTGAACAACGGGAGAATCGTCGTTGACTTCAAAATAGA
 
. : . : . : . : . : . :
JMFS092A11+ AACCACTTGGAGGCTCGTAATTCTCAGGAAATGCACCAGCAAAAATCTGTGAGGATGTGC
JMFS026A03+ AACCACTTGGAGGCTCGTAATTCTCAGGAAATGCACCAGCAAAAATCTGTGAGGATGTGC
                      ____________________________________________________________
consensus AACCACTTGGAGGCTCGTAATTCTCAGGAAATGCACCAGCAAAAATCTGTGAGGATGTGC
 
. : . : . : . : . : . :
JMFS092A11+ CCAAACTTTTAGAAGCCCTCCAGACAACCTCAAGACTCTTCTCACCTTTCCGCTTTGCTC
JMFS026A03+ CCAAACTTTTAGAAGCCCTCCAGACAACCTCAAGACTCTTCTCACCTTTCCGCTTTGCTC
JMFS014G06+ CTCACCTTTCCGCTTTGCTC
                      ____________________________________________________________
consensus CCAAACTTTTAGAAGCCCTCCAGACAACCTCAAGACTCTTCTCACCTTTCCGCTTTGCTC
 
. : . : . : . : . : . :
JMFS092A11+ TGTCTTGGTAGTCAATTCGCCCAAAATAAAGAGAGTCAAATCCAACCTCAGCACCCAAAA
JMFS026A03+ TGTCTTGGTAGTCAATTCGCCCAAAATAAAGAGAGTCAAATCCAACCTCAGCACCCAAAA
JMFS014G06+ TGTCTTGGTAGTCAATTCGCCCAAAATAAAGAGAGTCAAATCCAACCTCAGCACCCAAAA
                      ____________________________________________________________
consensus TGTCTTGGTAGTCAATTCGCCCAAAATAAAGAGAGTCAAATCCAACCTCAGCACCCAAAA
 
. : . : . : . : . : . :
JMFS092A11+ GATATGCCTGAACTGCAGAGTGCCCAAACGGATCAATTTGCCAGCCAATTCGTGGGGTAA
JMFS026A03+ GATATGCCTGAACTGCAGAGTGCCCAAACGGATCAATTTGCCAGCCAATTCGTGGGGTAA
JMFS014G06+ GATATGCCTGAACTGCAGAGTGCCCAAACGGATCAATTTGCCAGCCAATTCGTGGGGTAA
JMFS058C09+ CAGCCAATTCGTGGGGTAA
                      ____________________________________________________________
consensus GATATGCCTGAACTGCAGAGTGCCCAAACGGATCAATTTGCCAGCCAATTCGTGGGGTAA
 
. : . : . : . : . : . :
JMFS092A11+ CATTGAACTGCTGT
JMFS026A03+ CATTGAACTGCTGTTTGATATACTGGTGTCCTAAGGTTGTCTGATCTATCATATCAATAT
JMFS014G06+ CATTGAACTGCTGTTTGATATACTGGTGTCCTAAGGTTGTCTGATCTATCATATCAATAT
JMFS058C09+ CATTGAACTGCTGTTTGATATACTGGTGTCCTAAGGTTGTCTGATCTATCATATCAATAT
JMFS088E05+ GAACTGCTGTTTGATATACTGGTGTCCTAAGGTGGTCTGATCTATCATATCAATAT
                      ____________________________________________________________
consensus CATTGAACTGCTGTTTGATATACTGGTGTCCTAAGGTTGTCTGATCTATCATATCAATAT
 
. : . : . : . : . : . :
JMFS026A03+ AATGTGTAGCAGCTTCATCATGCATGCACCAACCCCCATTTATGAACTCAAGTTGACCCG
JMFS014G06+ AATGTGTAGCAGCTTCATCATGCATGCACCAACCCCCATTTATGAACTCAAGTTGACCCG
JMFS058C09+ AATGTGTAGCAGCTTCATCATGCATGCACCAACCCCCATTTATGAACTCAAGTTGACCCG
JMFS088E05+ AATGTGTAGCAGCTTCATCATGCATGCACCAACCCCCATTTATGAACTCAAGTTGACCCG
                      ____________________________________________________________
consensus AATGTGTAGCAGCTTCATCATGCATGCACCAACCCCCATTTATGAACTCAAGTTGACCCG
 
. : . : . : . : . : . :
JMFS026A03+ AATTGACTAGCCCCCGGACTGTACTCTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
JMFS014G06+ AATTGACTAGCCCCCGGACTGTACTCTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
JMFS058C09+ AATTGACTAGCCCCCGGACTGTACTCTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
JMFS088E05+ AATTGACTAGCCCCCGGACTGTACTCTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
JMFS103B09+ GCCGGACTTTGGTTCCTCCACCACCTCT
JMFS148B04+ CTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
JMFS117C02+ GGACTTTGGTTCCTCCACCACCTCT
                      ____________________________________________________________
consensus AATTGACTAGCCCCCGGACTGTACTCTGCATTGCCGGACTTTGGTTCCTCCACCACCTCT
 
. : . : . : . : . : . :
JMFS026A03+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS014G06+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS058C09+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS088E05+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS103B09+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS148B04+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
JMFS117C02+ GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTNTATCAGCTAACAATGCCGGAA
                      ____________________________________________________________
consensus GGAAAAATGCCTGTTCAACATAGATAAATTTCCTGTTTTTATCAGCTAACAATGCCGGAA
 
. : . : . : . : . : . :
JMFS026A03+ TCAAG
JMFS014G06+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
JMFS058C09+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
JMFS088E05+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
JMFS103B09+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
JMFS148B04+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
JMFS117C02+ TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
                      ____________________________________________________________
consensus TCAAGGAATCCAATACATTTTGCACACAAGCTCCCTGGATTGAATTATTGGAGCCAACAT
 
. : . : . : . : . : . :
JMFS014G06+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
JMFS058C09+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
JMFS088E05+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
JMFS103B09+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
JMFS148B04+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
JMFS117C02+ AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
                      ____________________________________________________________
consensus AGTACTGGTCAACAGTCTTCAACCAACCAACATCATCGTGAGTGTGAGGAACCAAATGAA
 
. : . : . : . : . : . :
JMFS014G06+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
JMFS058C09+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
JMFS088E05+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
JMFS103B09+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
JMFS148B04+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
JMFS117C02+ CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
                      ____________________________________________________________
consensus CATTGAGCTTCCCGGGAACAATGGCGGCCGAAGTATCGTACACTACGTACTTCGACTCCG
 
. : . : . : . : . : . :
JMFS014G06+ CACACAACACACCCACCGCGAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
JMFS058C09+ CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
JMFS088E05+ CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
JMFS103B09+ CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
JMFS148B04+ CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
JMFS117C02+ CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
                      ____________________________________________________________
consensus CACACAACACACCCACCGCAAGAGTCAACGACAAGAACCAAAATTCAACCTTCGCCATGG
 
. : . : . : . : . : . :
JMFS058C09+ GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
JMFS088E05+ GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
JMFS103B09+ GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
JMFS148B04+ GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
JMFS117C02+ GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
                      ____________________________________________________________
consensus GTTGCAGATGACACCCAATCTTGACAATCGATCAAACACCCAGAATATATATAGAGAGAC
 
. : . : . : . : . : . :
JMFS058C09+ ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
JMFS088E05+ ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
JMFS103B09+ ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
JMFS148B04+ ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
JMFS117C02+ ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
                      ____________________________________________________________
consensus ACTAAACACTAAAGAACAAAATCAAGAATCATTGCAGGCGTTGATGTCACATACAAATTC
 
. : . : . : . : . : . :
JMFS058C09+ CACTCTTCCTTCACTTCCAAAAG
JMFS088E05+ CACTCTTCCTTCACTTCCAAAAGAGGTCTCAACAAACAGCGGGTCGCTTTCTCGATGTGT
JMFS103B09+ CACTCTTCCTTCACTTCCAAAAGAGGTCTCAACAAACAGCGGGTCGCTTTCTCGATGTGT
JMFS148B04+ CACTCTTCCTTCACTTCCAAAAGAGGTCTCAACAAACAGCGGGTCGCTTTCTCGATGTGT
JMFS117C02+ CACTCTTCCTTCACTTCCAAAAGAGGTCTCAACAAACAGCGGGTCGCTTTCTCGATGTGT
                      ____________________________________________________________
consensus CACTCTTCCTTCACTTCCAAAAGAGGTCTCAACAAACAGCGGGTCGCTTTCTCGATGTGT
 
. : . : . : . : . : . :
JMFS088E05+ GGG-TTTACCGGATTGTTG
JMFS103B09+ GGGTTTTACCGGATTGTTGATAAGATCGCAAATGATTGTGGAAATGA
JMFS148B04+ GGGTTTTACCGGATTGTTGATAAGATCGCAAATGATTGTGGAAATGATATTTGGATTGAT
JMFS117C02+ GGGTTTTACCGGATTGTTGATAAGATCGCAAATGATTGTGGAAATGATATTTGGATTGAT
                      ____________________________________________________________
consensus GGGTTTTACCGGATTGTTGATAAGATCGCAAATGATTGTGGAAATGATATTTGGATTGAT
 
. : . : . : . : . : . :
JMFS148B04+ TATTTTAAGTTTCTTTATAGCTTTACTTAA
JMFS117C02+ TATTTTAAGTTTCTTTATAGCTTTACTTAATAGGGAGAGTGTTCGTCTATGGAAATGTGA
                      ____________________________________________________________
consensus TATTTTAAGTTTCTTTATAGCTTTACTTAATAGGGAGAGTGTTCGTCTATGGAAATGTGA