Previous Contig 003817:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015J11Sequence268003817 (8)554003243 (6)
JMFF033O10Sequence224003817 (8)698003243 (6)gb:AE005173_8932332e-04Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153
JMFS003A03Sequence569003817 (8)gb:AC007087_15352164e-10Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete sequence.>gb:
JMFS042C03Sequence620003817 (8)gb:AC007087_15352162e-07Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete sequence.>gb:
JMFS070G03Sequence617003817 (8)gb:AE005173_8932338e-06Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153
JMFS115G09Sequence633003817 (8)gb:AE005173_8932338e-06Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153
JMFS143H03Sequence614003817 (8)gb:AE005173_8932338e-06Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153
JMSF024D23Sequence583003817 (8)gb:AE005173_8932337e-06Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153783003243 (6)gb:AE005173_8932338e-16Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC008007_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS003A03+ TATTCAACGGCGGGGAGTTGACGGAGCACCCGCCGGAGTATATTAGAGAGGGGG
                      ____________________________________________________________
consensus TATTCAACGGCGGGGAGTTGACGGAGCACCCGCCGGAGTATATTAGAGAGGGGG
 
. : . : . : . : . : . :
JMFS003A03+ CACCAGCCGAGTGAGAGCGCGCGTGACGCGGCTTAAACCTGCGCGTCCCCGGTGAACTCT
JMFS042C03+ CAGCCGAGTGAGAGCGCGCGTGACGCGGCTTAAACCTGCGCGTCCCCGGTGAACTCT
JMFS143H03+ TAAACCTGCGCGTCCCCGGTGAACTCT
                      ____________________________________________________________
consensus CACCAGCCGAGTGAGAGCGCGCGTGACGCGGCTTAAACCTGCGCGTCCCCGGTGAACTCT
 
. : . : . : . : . : . :
JMFS003A03+ CCGCCGAGCCCGAAAGCTCACCGGAGTTGTTACAATCGGACTTCTTCGACACCAAGCTCG
JMFS042C03+ CCGCCGAGCCCGAAAGCTCACCGGAGTTGTTACAATCGGACTTCTTCGACACCAAGCTCG
JMFS143H03+ CCGCCGAGCCCGAAAGCTCACCGGAGTTGTTACAATCGGACTTCTTCGACACCAAGCTCG
JMFS070G03+ GCCGAGCCCGAAAGCTCACCGGAGTTGTTACAATCGGACTTCTTCGACACCAAGCTCG
JMSF024D23+ TCGACACCAAGCTCG
JMFS115G09+ TGTTACAATCGGACTTCTTCGACACCAAGCTCG
                      ____________________________________________________________
consensus CCGCCGAGCCCGAAAGCTCACCGGAGTTGTTACAATCGGACTTCTTCGACACCAAGCTCG
 
. : . : . : . : . : . :
JMFS003A03+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
JMFS042C03+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
JMFS143H03+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
JMFS070G03+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
JMSF024D23+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
JMFS115G09+ GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
                      ____________________________________________________________
consensus GCCCGGCCCGGCCCGACACCGATCCGGACGAGCTAGAGCTACTACTAGTAGTAGTTGTTG
 
. : . : . : . : . : . :
JMFS003A03+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
JMFS042C03+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
JMFS143H03+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
JMFS070G03+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
JMSF024D23+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
JMFS115G09+ TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
                      ____________________________________________________________
consensus TTGTAGTGGTAGTAGCAGTAGTCGCCGCAGAGCCCCCATTCCGGCGAGCCGGCAGCGGCG
 
. : . : . : . : . : . :
JMFS003A03+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
JMFS042C03+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
JMFS143H03+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
JMFS070G03+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
JMSF024D23+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
JMFS115G09+ AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
                      ____________________________________________________________
consensus AAACGGGCGAGCCCAGATCGAGCTCCCGGAAATCGGGCTTGTTAACTTCCGACCCAAATG
 
. : . : . : . : . : . :
JMFS003A03+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
JMFS042C03+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
JMFS143H03+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
JMFS070G03+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
JMSF024D23+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATNTCCGACACCGACCCTNTCCGAG
JMFS115G09+ AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
                      ____________________________________________________________
consensus AGCTCCTCAACCTATCGCTCAAACCGTCAATCCCAATCTCCGACACCGACCCTCTCCGAG
 
. : . : . : . : . : . :
JMFS003A03+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
JMFS042C03+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
JMFS143H03+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
JMFS070G03+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
JMSF024D23+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACNCAA
JMFS115G09+ AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
                      ____________________________________________________________
consensus AATGCGGCATTTCAAACCCACCCTTCCCTCCGGCAAACAAATATAAATATATATACACAA
 
. : . : . : . : . : . :
JMFS003A03+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
JMFS042C03+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
JMFS143H03+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
JMFS070G03+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
JMSF024D23+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
JMFF015J11+ TATAAGTGTTTCCTCCTCGCTTAGCNCTGAGAGTCAGCAGCAATGTNTGGAGAAAGCA
JMFF033O10+ TGGAGAAAGCA
JMFS115G09+ ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
                      ____________________________________________________________
consensus ACTATAAGTGTTTCCTCCTCGCTTAGCACTGAGAGTCAGCAGCAATGTCTGGAGAAAGCA
 
. : . : . : . : . : . :
JMFS003A03+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGA
JMFS042C03+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMFS143H03+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMFS070G03+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMSF024D23+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMFF015J11+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMFF033O10+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
JMFS115G09+ GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
                      ____________________________________________________________
consensus GGTGAAAGAATGGAGAAGGGAGGCATTGAAGAAGACATGAGAAAAGGAGAAAGAAAAACA
 
. : . : . : . : . : . :
JMFS042C03+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMFS143H03+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMFS070G03+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMSF024D23+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMFF015J11+ GAGATAGATAGGGATNTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMFF033O10+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
JMFS115G09+ GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
                      ____________________________________________________________
consensus GAGATAGATAGGGATCTCGTGATATAAAAAAGGCAGAAGCAAAGAATGAATGCGATATTG
 
. : . : . : . : . : . :
JMFS042C03+ CGAGCGAGAATCGGCGGAAGAGA
JMFS143H03+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGA
JMFS070G03+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGATTTTTTT
JMSF024D23+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGA-TTTTTT
JMFF015J11+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGA-TTTTTT
JMFF033O10+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGA-TTTTTT
JMFS115G09+ CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGATTTTTTT
                      ____________________________________________________________
consensus CGAGCGAGAATCGGCGGAAGAGAGACACAGAGAGAAGGAGAGAGAGATTTTGA-TTTTTT
 
. : . : . : . : . : . :
JMFS070G03+ TTTTCTTTTCTTTTCTTTT
JMSF024D23+ TTTTCTTTTCTTTTCTTTTTCTTCTTC
JMFF015J11+ TTTTCTTTTCTTTTCTTTTTCTTCTTC
JMFF033O10+ TTTTCTTTTCTTTTCTTTTTCTTCTTC
JMFS115G09+ TTTTCTTTTCTTTTCTTTTTCTTCTTCACCTGCTGCTTCACGAGACACCTCTCTCTCCTC
                      ____________________________________________________________
consensus TTTTCTTTTCTTTTCTTTTTCTTCTTCACCTGCTGCTTCACGAGACACCTCTCTCTCCTC