Previous Contig 003816:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014I14Sequence533003816 (5)gb:AY254349_15930871e-39Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.638008879 (2)pir|T07065|T070656e-84probable lipoxygenase (EC 1.13.11.12) (clone H3) - potato>gb:ST13LH3_1722665 S.t
JMFS039A09Sequence627003816 (5)gb:AY254349_15930877e-61Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS050D08Sequence612003816 (5)gb:AY254349_15930873e-54Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS115E11Sequence642003816 (5)gb:AY254349_15930876e-58Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS129H07Sequence627003816 (5)gb:AY254349_15930877e-60Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS039A09+ ACTGAACCCATGAACTGCAGGGGAAATGAACCGGACCACTAGAGAACCCTTCAACAG
JMFS129H07+ ACCCATGAACTGCAGGGGAAATGAACCGGACCACTAGAGAACCCTTCAACAG
JMFS050D08+ GGGAAATGAACCGGACCACTAGAGAACCCTCAACCAG
JMFS115E11+ GGGAAATGAACCGGACCACTAGAGAACCCTTCAACAG
                      ____________________________________________________________
consensus ACTGAACCCATGAACTGCAGGGGAAATGAACCGGACCACTAGAGAACCCTTCAACAG
 
. : . : . : . : . : . :
JMFS039A09+ TAATCTTTTCAAGAAAGAATTCTTGTTGATGTTTGTTAACCACCGTTATAGCACCTGGAC
JMFS129H07+ TAATCTTTTCAAGAAAGAATTCTTGTTGATGTTTGTTAACCACCGTTATAGCACCTGGAC
JMFS050D08+ TAATCTTCTCAAGAAAGAATTCTTGTTGATGTTTGTTAACCACCGTTATAGCACCTGGAC
JMFS115E11+ TAATCTTTTCAAGAAAGAATTCTTGTTGATGTTTGTTAACCACCGTTATAGCACCTGGAC
                      ____________________________________________________________
consensus TAATCTTTTCAAGAAAGAATTCTTGTTGATGTTTGTTAACCACCGTTATAGCACCTGGAC
 
. : . : . : . : . : . :
JMFS039A09+ ACCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
JMFS129H07+ ACCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
JMFS050D08+ ACCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
JMFF014I14+ CCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
JMFS115E11+ ACCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
                      ____________________________________________________________
consensus ACCCAAAATTGGTGTCCAATTCAAACTCAACACTGTAATTAACTGTCTCTGTTTTCATCC
 
. : . : . : . : . : . :
JMFS039A09+ CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
JMFS129H07+ CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
JMFS050D08+ CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
JMFF014I14+ CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
JMFS115E11+ CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
                      ____________________________________________________________
consensus CAGTTTTAACCGCCCAGTCCTTCAACACCGCCGGTTCACTCTTCCTCGGACCCTTGGTTT
 
. : . : . : . : . : . :
JMFS039A09+ TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
JMFS129H07+ TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
JMFS050D08+ TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
JMFF014I14+ TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
JMFS115E11+ TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
                      ____________________________________________________________
consensus TAGGATCAATTTCTGTGCTGATAAGCTCCAACACAACATTCCTTCCCAACTGATCAGTGA
 
. : . : . : . : . : . :
JMFS039A09+ AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
JMFS129H07+ AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
JMFS050D08+ AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
JMFF014I14+ AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
JMFS115E11+ AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
                      ____________________________________________________________
consensus AAGCATCAAAACGTTTGATCAAAGCCTCCTTAAACCCTGCCTCCTTCTTGTTCCCCACAG
 
. : . : . : . : . : . :
JMFS039A09+ TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
JMFS129H07+ TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
JMFS050D08+ TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
JMFF014I14+ TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
JMFS115E11+ TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
                      ____________________________________________________________
consensus TCACCACAGCTCTGACCTTAAACTTCACCGCTTTCTCAGGAACCATCTTAAACACTCTCT
 
. : . : . : . : . : . :
JMFS039A09+ GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
JMFS129H07+ GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
JMFS050D08+ GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
JMFF014I14+ GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
JMFS115E11+ GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
                      ____________________________________________________________
consensus GCTCAACGCTGACAGACGCCATTGGAGCGATCCTCACGCCCCTCTTCAAACGCAGCCGGT
 
. : . : . : . : . : . :
JMFS039A09+ TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
JMFS129H07+ TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
JMFS050D08+ TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
JMFF014I14+ TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
JMFS115E11+ TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
                      ____________________________________________________________
consensus TCACGTGAACCCGGTTCTCAAGATTCACCATCCCACTCGATGAAGAAAGGAATGAACCTG
 
. : . : . : . : . : . :
JMFS039A09+ CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
JMFS129H07+ CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
JMFS050D08+ CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
JMFF014I14+ CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
JMFS115E11+ CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
                      ____________________________________________________________
consensus CCTTCGTCTTCATCTTCGTCTTGTCCATCACAGATAAACCCCAGAATTCATTCGCAAGAG
 
. : . : . : . : . : . :
JMFS039A09+ CCATGCTTAGCTTTCGATCTCGACCCAGAA
JMFS129H07+ CCATGCTTAGCTTTCGATCTCGACCCAGAAGTTAA
JMFS050D08+ CCATGCTTAGCTTTCGATCTCGACCCAGAAGTTAA
JMFF014I14+ CCATGCTTAGCTTTCGATCTCGACCCAGAAGTTAAGGTTGTCGGTTTCGATTCC
JMFS115E11+ CCATGCTTAGCTTTCGATCTCGACCCAGAAGTTAAGGTTGTCGGTTTCGATTCCTCTCCA
                      ____________________________________________________________
consensus CCATGCTTAGCTTTCGATCTCGACCCAGAAGTTAAGGTTGTCGGTTTCGATTCCTCTCCA