Previous Contig 003800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039H15Sequence470003800 (2)gb:AF123503_17699182e-78Nicotiana tabacum Nt-gh3 deduced protein mRNA, complete cds.617010202 (9)gb:AY525089_16115503e-61Capsicum chinense auxin and ethylene responsive GH3-like protein (GH3) mRNA, com
JMFS112E01Sequence627003800 (2)gb:AF123503_17699186e-63Nicotiana tabacum Nt-gh3 deduced protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039H15+ TTGTGTAGGACACTTCTGAAGGCTTACACATGGGGTTGAGATTCAGGCCGAAATAACAC
                      ____________________________________________________________
consensus TTGTGTAGGACACTTCTGAAGGCTTACACATGGGGTTGAGATTCAGGCCGAAATAACAC
 
. : . : . : . : . : . :
JMFF039H15+ TCCGACGAGGCGTACATGGTGCATGCCATCGGCAACCCGCCGCTGTAATAATCCAGCGTC
                      ____________________________________________________________
consensus TCCGACGAGGCGTACATGGTGCATGCCATCGGCAACCCGCCGCTGTAATAATCCAGCGTC
 
. : . : . : . : . : . :
JMFF039H15+ GGAATATACTGCGCCATGGCTCCGGTGACGATCACGTCCAGATACTTCGTCCCCGGCCAA
                      ____________________________________________________________
consensus GGAATATACTGCGCCATGGCTCCGGTGACGATCACGTCCAGATACTTCGTCCCCGGCCAA
 
. : . : . : . : . : . :
JMFF039H15+ ATTCTGGTGATAATTCCCTCCCAGTTCTCCTTCGAACATTCGCGGGCTATAAAGTCCGCC
                      ____________________________________________________________
consensus ATTCTGGTGATAATTCCCTCCCAGTTCTCCTTCGAACATTCGCGGGCTATAAAGTCCGCC
 
. : . : . : . : . : . :
JMFF039H15+ AACTCCGGGTCGGGCCTCATAACCCGTGTCATGCACTCGCAGATTGCCGGGTCTGTCACA
JMFS112E01+ CACTCGCAGATTGCCGGGTCTGTCACA
                      ____________________________________________________________
consensus AACTCCGGGTCGGGCCTCATAACCCGTGTCATGCACTCGCAGATTGCCGGGTCTGTCACA
 
. : . : . : . : . : . :
JMFF039H15+ TGCGGGCTCAGAATTCCGGTCCGGATGTCGTTACTCAACTGCGGCCAGTGTAGCTGGAGG
JMFS112E01+ TGCGGGCTCAGAATTCCGGTCCGGATGTCGTTACTCAACTGCGGCCAGTGTAGCTGGAGG
                      ____________________________________________________________
consensus TGCGGGCTCAGAATTCCGGTCCGGATGTCGTTACTCAACTGCGGCCAGTGTAGCTGGAGG
 
. : . : . : . : . : . :
JMFF039H15+ AACCTGATGGCCCGGAGAAGCCCCGAAGCAAAAATCGCGCCAAGTCGAAGCACTTGCTCC
JMFS112E01+ AACCTGATGGCCCGGAGAAGCCCCGAAGCAAAAATCGCGCCAAGTCGAAGCACTTGCTCC
                      ____________________________________________________________
consensus AACCTGATGGCCCGGAGAAGCCCCGAAGCAAAAATCGCGCCAAGTCGAAGCACTTGCTCC
 
. : . : . : . : . : . :
JMFF039H15+ CGCTCGTAGAGCCCGCAAAGCATTTGCGTGTACATACTCTGGAAAGAGTCC
JMFS112E01+ CGCTCGTAGAGCCCGCAAAGCATTTGCGTGTACATACTCTGGAAAGAGTCCGGGCAAAGT
                      ____________________________________________________________
consensus CGCTCGTAGAGCCCGCAAAGCATTTGCGTGTACATACTCTGGAAAGAGTCCGGGCAAAGT
 
. : . : . : . : . : . :
JMFS112E01+ ATGGCTTCATTCGGGCTGGTGTAGACGTTATACGGGTCGTAAGCCCGGGTCCTGAAGTGC
                      ____________________________________________________________
consensus ATGGCTTCATTCGGGCTGGTGTAGACGTTATACGGGTCGTAAGCCCGGGTCCTGAAGTGC
 
. : . : . : . : . : . :
JMFS112E01+ TCACTCTTGTAGTAGCTGGTAAGAACGGGCCGGGCCACAAGCCCTCCCGGCGTCTTCGTC
                      ____________________________________________________________
consensus TCACTCTTGTAGTAGCTGGTAAGAACGGGCCGGGCCACAAGCCCTCCCGGCGTCTTCGTC
 
. : . : . : . : . : . :
JMFS112E01+ TCAGACTTCACAAACATGAAGTATAACCCCTTTCCCTTGTTTAATCCAGGCACGTAACTG
                      ____________________________________________________________
consensus TCAGACTTCACAAACATGAAGTATAACCCCTTTCCCTTGTTTAATCCAGGCACGTAACTG
 
. : . : . : . : . : . :
JMFS112E01+ TTACATACACAAAACAAGCAAAATATTATTAGAATATAATAAAAACACTAAAATAACTTA
                      ____________________________________________________________
consensus TTACATACACAAAACAAGCAAAATATTATTAGAATATAATAAAAACACTAAAATAACTTA
 
. : . : . : . : . : . :
JMFS112E01+ AGTTATTCGTAACTATTTAATCTGACGAATTTGGCTGGGGTTATATTAATATTTTTTACT
                      ____________________________________________________________
consensus AGTTATTCGTAACTATTTAATCTGACGAATTTGGCTGGGGTTATATTAATATTTTTTACT
 
. : . : . : . : . : . :
JMFS112E01+ TGAGTTAAATACTTACAGGTTCATAACAGGCATGAGAAGGCTGTAAAGAAGTTGACGACG
                      ____________________________________________________________
consensus TGAGTTAAATACTTACAGGTTCATAACAGGCATGAGAAGGCTGTAAAGAAGTTGACGACG
 
. : . : . : . : . : . :
JMFS112E01+ ATCCAGCTCCTCTTTGATTGTGGGCATCAATTTTCTCTCGCCAGCTGACGTTCCAGAGCT
                      ____________________________________________________________
consensus ATCCAGCTCCTCTTTGATTGTGGGCATCAATTTTCTCTCGCCAGCTGACGTTCCAGAGCT