Previous Contig 003797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032H19Sequence468003797 (6)gb:AY064040_15659781e-38Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m654009718 (2)gb:AP005759_18573772e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P055
JMFF040G09Sequence540003797 (6)gb:AY064040_15659781e-49Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m
JMFS009G01Sequence574003797 (6)gb:AY064040_15659786e-55Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m
JMFS100B01Sequence623003797 (6)gb:AP005759_18573774e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P055
JMFS112C08Sequence618003797 (6)gb:AY064040_15659781e-55Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m
JMSF002D14Sequence301003797 (6)gb:AY064040_15659782e-14Arabidopsis thaliana putative cellulose synthase catalytic subunit (At1g55850) m753009718 (2)gb:AP005759_18573774e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P055

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS100B01+ TACCACTTCCCATGGCTACCTCAATCCTGTTTCTCATTTCTTCATAT
                      ____________________________________________________________
consensus TACCACTTCCCATGGCTACCTCAATCCTGTTTCTCATTTCTTCATAT
 
. : . : . : . : . : . :
JMFS100B01+ AATTTCTTAGTATTGAACCATTCTTCTGCAAACATTTGGTCGTGTCCATCATCAATGTTT
JMFS009G01+ CATGAATGTTT
JMFS112C08+ AATGTTT
                      ____________________________________________________________
consensus AATTTCTTAGTATTGAACCATTCTTCTGCAAACATTTGGTCGTGTCCATCATGAATGTTT
 
. : . : . : . : . : . :
JMFS100B01+ TGAGCAAAATAGACTTGTGGGGATCTTGGCTCTACCTTAAACTTGTTGCAGAAGGGTATC
JMFS009G01+ TGAGAGAAGTATACTTGTGGGGATCTTGGCTCCACCTTAAACTTGTTGCAGAAGGGTATC
JMFF040G09+ TTGCAGAAGGGTATC
JMFS112C08+ CGAGCAAAATAGACTTGTGGGGATCTTGGCTCCACCTTAAACTTGTTGCAGAAAGGTATC
                      ____________________________________________________________
consensus TGAGCAAAATAGACTTGTGGGGATCTTGGCTCCACCTTAAACTTGTTGCAGAAGGGTATC
 
. : . : . : . : . : . :
JMFS100B01+ CAATACTTGGAGAATTTAGAGGCTTCCAAAAGAGCGTAAAATGTAAACTCCGACCCTCCA
JMFS009G01+ CAATGCTTGGAGAACGTAGAGGCTTCCAAAAGAGCGTAGAATGTAAACTCCGACCCTCCA
JMFF040G09+ CAATGCTTGGAGAACGTAGAGGCTTCCAAAAGAGCGTAGAATGTAAACTCCGACCCTCCA
JMFS112C08+ CAATACTTAGAGAATTTAGAGGCTTCCAAAAGAGCGTAGAATGTAAACTCCGACCCTCCA
                      ____________________________________________________________
consensus CAATGCTTGGAGAATTTAGAGGCTTCCAAAAGAGCGTAGAATGTAAACTCCGACCCTCCA
 
. : . : . : . : . : . :
JMFS100B01+ TCATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGAAAGATAACACTGATAAC
JMFS009G01+ TCATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGTATGACAACACTGATAAC
JMFF040G09+ TCATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGTATGACAACACTGATAAC
JMFF032H19+ ATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGAACGACAACACTGATAAC
JMFS112C08+ TCATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGAAAGATAACACTGATAAC
                      ____________________________________________________________
consensus TCATCTGATAGGTAAACACTCAACTTGTGAGGGGGATAATTGAATGACAACACTGATAAC
 
. : . : . : . : . : . :
JMFS100B01+ ACAGTGTTAATCACCAGCGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACAAAAACA
JMFS009G01+ ACAGTGTTAATCACCAAAGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACGAAAACA
JMFF040G09+ ACAGTGTTAATCACCAAAGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACGAAAACA
JMFF032H19+ ACAGTGTTAATCACCAACGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACGAAAACA
JMFS112C08+ ACAGTGTTAATCACCAGTGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACAAAAACA
                      ____________________________________________________________
consensus ACAGTGTTAATCACCAACGTTGGCGGCTCCAATATGGGATCTGCTGTGCATACGAAAACA
 
. : . : . : . : . : . :
JMFS100B01+ TCCACCCCCGGCAACTTCTCCTCGTATCTGAGGGAGAGGCTTTCTTTGAAGGGGCAAGTG
JMFS009G01+ TCCACCCCCGGCAACTCCTCCTCATATCTGAGGGATAGCCTTTCTTTGAAGGGAGAAGTG
JMFF040G09+ TCCACCCCCGGCAACTCCTCCTCATATCTGAGGGATAGCCTTTCTTTGAAGGGAGAAGTG
JMFF032H19+ TCCACCCCCGGCAACTCCTCCTCGTATCTGAGGGATAGCCTTTGTTTGAAGGGGAAAGTG
JMSF002D14+ GGGGAAAGTG
JMFS112C08+ TCCACCTCCGGCAACTTCTCCTCGTATCTGAGGGAGAGCCTTTCTTTGAAGGGGCAAGTG
                      ____________________________________________________________
consensus TCCACCCCCGGCAACTCCTCCTCGTATCTGAGGGATAGCCTTTCTTTGAAGGGGGAAGTG
 
. : . : . : . : . : . :
JMFS100B01+ TAAGCAACATCCCAGCGAGCAGACTGAGTAAAAATCCAATAAATACCAAAGAAAACCTCG
JMFS009G01+ TAAGCAACATCCCAGCGAGCAGACTGAGTAAAGATCCAATAAATACCAAACAAAACCTCG
JMFF040G09+ TAAGCAACATCCCAGCGAGCAGACTGAGTAAAGATCCAATAAATACCAAACAAAACCTCG
JMFF032H19+ TAGGCAACATCCCAGCGAGCAGACTGAGTAAAGATCCAATAAATACCAAACAAAACCTCG
JMSF002D14+ TAGGCAACATCCCAGCGAGCAGACTGAGTAAAGATCCAATAAATACCAAACAAAACCTCG
JMFS112C08+ TAAGTAACATCCCAGCGAGCAGACTGAGTTAAAATCCAATAAATACCAAAGAAAACCTCG
                      ____________________________________________________________
consensus TAAGCAACATCCCAGCGAGCAGACTGAGTAAAGATCCAATAAATACCAAACAAAACCTCG
 
. : . : . : . : . : . :
JMFS100B01+ GAAATGAACATCCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTG
JMFS009G01+ GAAATGAACATTCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTA
JMFF040G09+ GAAATGAACATTCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTA
JMFF032H19+ GAAATGAACATTCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTA
JMSF002D14+ GAAATGAACATTCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTA
JMFS112C08+ GAAATGAACATCCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTG
                      ____________________________________________________________
consensus GAAATGAACATTCCAATCCATGCCCATCTTCCTGCTTCCCCTGTTGTTGGGATATTTGTA
 
. : . : . : . : . : . :
JMFS100B01+ AATCTGTAAAACCATATGAAGCAGATGGCCAAGAAAACTGTTACTGAAAACAACTTGTAC
JMFS009G01+ AACCTGTAAAACCATATGGAGCAGATAGCGAAGAAAACTGTTAGTGAAAACAGCTTGTAA
JMFF040G09+ AACCTGTAAAACCATATGGAGCAGATAGCGAAGAAAACTGTTAGTGAAAACAGCTTGTAA
JMFF032H19+ AACCTGTAAAACCATATGAAGCAGATAGCCAAGAAAACTGTTAGGGAAAACAGCTTGTAG
JMSF002D14+ AACCTGTAAAACCATATGAAGCAGATAGCCAAGAAAACTGTTAGGGAAAACAGCTTGTAG
JMFS112C08+ AATCTGTAAAACCATATGAAGCAGATGGCCAAGAAAACTGTTACTGAAAACAACTTGTAC
                      ____________________________________________________________
consensus AACCTGTAAAACCATATGAAGCAGATAGCCAAGAAAACTGTTAGTGAAAACAGCTTGTAG
 
. : . : . : . : . : . :
JMFS100B01+ GCAGTGTTCCCTCTCCTTGGGTTTGTCTCAAACAGT
JMFS009G01+ GCAGTATTTCCCTTCCTTGGTTTTGTCTCAAACAGTGGAAGCTCAACACTCTGCTTTTCT
JMFF040G09+ GCAGTATTTCCCTTCCTTGGTTTTGTCTCAAACAGTGGAAGCTCAACACTCTGCTTTTCT
JMFF032H19+ GCAGTATTGCCCTTCCTTGGTTTTGTCTCAAACAGTGGAAGCTCCACGCTCTGCTTTTCA
JMSF002D14+ GCAGTATTGCCCTTCCTTGGTTTTGTCTCAAACAGTGGAAGCTCCACGCTCTGCTTTTCA
JMFS112C08+ GCAGTGTTCCCTCTCCTTGGGTTTGTCTCAAACAGTGGAAGCTCAACACTCTGCTTTTCT
                      ____________________________________________________________
consensus GCAGTATTTCCCTTCCTTGGTTTTGTCTCAAACAGTGGAAGCTCAACACTCTGCTTTTCT
 
. : . : . : . : . : . :
JMFS009G01+ TCTTCCCTTCCATTCT
JMFF040G09+ TCTTCCCTTCCATTCTTCCCACCCATCTC
JMFF032H19+ TCTTCCCTTCCATTCTTCCCACCCATCTC-TCT
JMSF002D14+ TCTTCCCTTCCATTCTTCCCACCCATCTC-TCT
JMFS112C08+ TCTTCCCTTCCCTTCCCCCCACCCATCTCATCTCTTCTTTGTTTCAGTAGAGTTGTAGAA
                      ____________________________________________________________
consensus TCTTCCCTTCCATTCTTCCCACCCATCTC-TCTCTTCTTTGTTTCAGTAGAGTTGTAGAA