Previous Contig 003793:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS029D01Sequence619003793 (5)gb:NTA294474_16913117e-21Nicotiana tabacum mRNA for SET-domain-containing protein (set1 gene).
JMFS063E08Sequence619003793 (5)
JMFS112A02Sequence627003793 (5)
JMFS129G07Sequence626003793 (5)
JMFS162G05Sequence533003793 (5)gb:NTA294474_16913115e-18Nicotiana tabacum mRNA for SET-domain-containing protein (set1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029D01+ TTTCAATTTACNCCGTCTCCCTCCAGTACTCGTGTCTTCGTCATCATTACCTTGCATCCC
JMFS162G05+ CATCCC
                      ____________________________________________________________
consensus TTTCAATTTACNCCGTCTCCCTCCAGTACTCGTGTCTTCGTCATCATTACCTTGCATCCC
 
. : . : . : . : . : . :
JMFS029D01+ AAAGTCACTCTGGTTCTGGGAGTCACTAAACGCATCATCTTCCACAACTCTTCTAGTGGT
JMFS162G05+ AAAGTCACTCTGGTTCTGGGAGTCACTAAACGCATCATCTTCCACAACTCTTNTAGTGGT
                      ____________________________________________________________
consensus AAAGTCACTCTGGTTCTGGGAGTCACTAAACGCATCATCTTCCACAACTCTTCTAGTGGT
 
. : . : . : . : . : . :
JMFS029D01+ CCTCTTTGACTTCACAGAACTTCCATTTGCCATTGGAGTTCTGAACGAATTTAACGGAAC
JMFS162G05+ CCTCTTTGACTTCACAGAACTTCCATTTGCCATTGGAGTTCTGAACGAATTTAACGGAAC
                      ____________________________________________________________
consensus CCTCTTTGACTTCACAGAACTTCCATTTGCCATTGGAGTTCTGAACGAATTTAACGGAAC
 
. : . : . : . : . : . :
JMFS029D01+ AGGGGATATCGGGTGACCAAAAGACCCTTGTTGAGCCGGTCTTCCTCCCGAGTCATGAGA
JMFS162G05+ AGGGGATATCGGGTGACCAAAAGACCCTTGTTGAGCCGGTCTTCCTCCCGAGTCATGAGA
                      ____________________________________________________________
consensus AGGGGATATCGGGTGACCAAAAGACCCTTGTTGAGCCGGTCTTCCTCCCGAGTCATGAGA
 
. : . : . : . : . : . :
JMFS029D01+ CAAAAACGGGTAAAACGGAGACACTCCGGGAGGGAAAGGACCACTCGGGGGAACACACAC
JMFS162G05+ CAAAAACGGGTAAAACGGAGACACTCCGGGAGGGAAAGGACCACTCGGGGGAACACACAC
                      ____________________________________________________________
consensus CAAAAACGGGTAAAACGGAGACACTCCGGGAGGGAAAGGACCACTCGGGGGAACACACAC
 
. : . : . : . : . : . :
JMFS029D01+ AAAGGGCGAAGGTTGTGGAGAACCAACTGGCGACATCCCACTCGCAGATGGAAATACAGG
JMFS162G05+ AAAGGGCGAAGGTTGTGGAGAACCAACTGGCGACATCCCACTCGCAGATGGAAATACAGG
                      ____________________________________________________________
consensus AAAGGGCGAAGGTTGTGGAGAACCAACTGGCGACATCCCACTCGCAGATGGAAATACAGG
 
. : . : . : . : . : . :
JMFS029D01+ AACTAAACATTTTAAAGGCTTTACATCCAAGACCCTAGACATATCAACAGACCCAGATGT
JMFS162G05+ AACTAAACATTTTAAAGGCTTTACATCCAAGACCCTAGACATATCAACAGACCCAGATGT
                      ____________________________________________________________
consensus AACTAAACATTTTAAAGGCTTTACATCCAAGACCCTAGACATATCAACAGACCCAGATGT
 
. : . : . : . : . : . :
JMFS029D01+ TCGAGCCGAGTTTGAAGCTGTACCTTGCTCCATTTAAGCAGAACTTTGCAATCAACCAAC
JMFS162G05+ TCGAGCCGAGTTTGAAGCTGTACCTTGCTCCATTTAAGCAGAACTTTCCAATCAACCAAC
JMFS129G07+ TGTACCTTGCTCCATTTAAGCAGAACTTTCCAATCAACCAAC
                      ____________________________________________________________
consensus TCGAGCCGAGTTTGAAGCTGTACCTTGCTCCATTTAAGCAGAACTTTCCAATCAACCAAC
 
. : . : . : . : . : . :
JMFS029D01+ CACACAAAAATCACAAATTTCAATCACATTAATCCCCAAAACACAACCTTTCACCACCTT
JMFS162G05+ CACACAAAAATCACAAATTTCAATCACATTAATCCCCAAAACACAACCTTTCACCACCTT
JMFS129G07+ CACACAAAAATCACAAATTTCAATCACATTAATCCCCAAAACACAACCTTTCACCACCTT
JMFS063E08+ CATTAATCCCCAAAACACAACCTTTCACCACCTT
JMFS112A02+ CCCCAAAACACAACCTTTCACCACCTT
                      ____________________________________________________________
consensus CACACAAAAATCACAAATTTCAATCACATTAATCCCCAAAACACAACCTTTCACCACCTT
 
. : . : . : . : . : . :
JMFS029D01+ TAAACTTAACCTTTGCT
JMFS162G05+ TAAACTTAACCTTTGCTACAAAAAACAAACCCATGTCAAAGAAA
JMFS129G07+ TAAACTTAACCTTTGCTACAAAAAACAAACCCATGTCAAAGAAATGCCATCTGAAATTCT
JMFS063E08+ TAAACTTAACCTNTGCTACAAAAAACAAACCCATGTCAAAGAAATGCCATCTGAAATTCT
JMFS112A02+ TAAACTTAACCTTTGCTACAAAAAACAAACCCATGTCAAAGAAATGCCATCTGAAATTCT
                      ____________________________________________________________
consensus TAAACTTAACCTTTGCTACAAAAAACAAACCCATGTCAAAGAAATGCCATCTGAAATTCT
 
. : . : . : . : . : . :
JMFS129G07+ GAACAACAAAAATATCATTTCTTTAAACCATGCAGCAAACAATCAGAAGAGATTCATTAC
JMFS063E08+ GAACAACAAAAATATCATTTCTTTAAACCATGCAGCAAACAATCAGAAGAGATTCATTAC
JMFS112A02+ GAACAACAAAAATATCATTTCTTTAAACCATGCAGCAAACAATCAGAAGAGATTCATTAC
                      ____________________________________________________________
consensus GAACAACAAAAATATCATTTCTTTAAACCATGCAGCAAACAATCAGAAGAGATTCATTAC
 
. : . : . : . : . : . :
JMFS129G07+ CAAATCCCCCAAAGATACAAGCTTTAACTTAATTACACAAACATATTGCTCCCTACACCA
JMFS063E08+ CAAATCCCCCAAAGATACAAGCTTTAACTTAATTACACAAACATATTGCTCCCTACACCA
JMFS112A02+ CAAATCCCCCAAAGATACAAGCTTTAACTTAATTACACAAACATATTGCTCCCTACACCA
                      ____________________________________________________________
consensus CAAATCCCCCAAAGATACAAGCTTTAACTTAATTACACAAACATATTGCTCCCTACACCA
 
. : . : . : . : . : . :
JMFS129G07+ TGGAAACACTAGAAAATCAATGATAACCCCCAATATCCAAATAAAGATTCAAACTTTCAC
JMFS063E08+ TGGAAACACTAGAAAATCAATGATAACCCCCAATATCCAAATAAAGATTCAAACTTTCAC
JMFS112A02+ TGGAAACACTAGAAAATCAATGATAACCCCCAATATCCAAATAAAGATTCAAACTTTCAC
                      ____________________________________________________________
consensus TGGAAACACTAGAAAATCAATGATAACCCCCAATATCCAAATAAAGATTCAAACTTTCAC
 
. : . : . : . : . : . :
JMFS129G07+ GAAATGAACAGAAAGGAGAAAAGCCCTAGTTTAGCTAATTGCTAAATACCAAAATCCATA
JMFS063E08+ GAAATGAACAGAAAGGAGAAAAGCCCTAGTTTAGCTAATTGCTAAATACCAAAATCCATA
JMFS112A02+ GAAATGAACAGAAAGGAGAAAAGCCCTAGTTTAGCTAATTGCTAAATACCAAAATCCATA
                      ____________________________________________________________
consensus GAAATGAACAGAAAGGAGAAAAGCCCTAGTTTAGCTAATTGCTAAATACCAAAATCCATA
 
. : . : . : . : . : . :
JMFS129G07+ ATCGACTTTAGCATAAATAATTTTTTTTTTAAGCAAAAATCGCATAAAAAATCATAATTA
JMFS063E08+ ATCGACTTTAGCATAAATAATTTTTTTTTTAAGCAAAAATCGCATAAAAAATCATAATTA
JMFS112A02+ ATCGACTTTAGCATAAATAATTTTTTTTTTAAGCAAAAATCGCATAAAAAATCATAATTA
                      ____________________________________________________________
consensus ATCGACTTTAGCATAAATAATTTTTTTTTTAAGCAAAAATCGCATAAAAAATCATAATTA
 
. : . : . : . : . : . :
JMFS129G07+ AGCCTAACAAAGTCAATATCAAAGGCCTTATGTAGCAAGTATAGAGAAAAGGTGTCAGAA
JMFS063E08+ AGCCTAACAAAGTCAATATCAAAGGCCTTATGTAGCAAGTATAGAGAAAAGGTGTCAGAA
JMFS112A02+ AGCCTAACAAAGTCAATATCAAAGGCCTTATGTAGCAAGTATAGAGAAAAGGTGTCAGAA
                      ____________________________________________________________
consensus AGCCTAACAAAGTCAATATCAAAGGCCTTATGTAGCAAGTATAGAGAAAAGGTGTCAGAA
 
. : . : . : . : . : . :
JMFS129G07+ AAATTAAAGATAACTTTTTTATCAGTCTTTTCCGCAATAAAATGGACCTAAAAACAGAAC
JMFS063E08+ AAATTAAAGATAACTTTTTTATCAGTCTTTTCCGCAATAAAATGGACCTAAAAACAGAAC
JMFS112A02+ AAATTAAAGATAACTTTTTTATCAGTCTTTTCCGCAATAAAATGGACCTAAAAACAGAAC
                      ____________________________________________________________
consensus AAATTAAAGATAACTTTTTTATCAGTCTTTTCCGCAATAAAATGGACCTAAAAACAGAAC
 
. : . : . : . : . : . :
JMFS129G07+ CAAGATTGTAGATCAGAAATTAAAGCAAACGGAAAGAGAAATGA
JMFS063E08+ CAAGATTGTAGATCAGAAATTAAAGCAAACGGAAAGAGAAATGATCTATCATTACAAAAT
JMFS112A02+ CAAGATTGTAGATCAGAAATTAAAGCAAACGGAAAGAGAAATGATCTATCATTACAAAAT
                      ____________________________________________________________
consensus CAAGATTGTAGATCAGAAATTAAAGCAAACGGAAAGAGAAATGATCTATCATTACAAAAT
 
. : . : . : . : . : . :
JMFS063E08+ ACTCCGTACCTTAGAAACTTTTGGTAGAGAGCTGAGATTTATGGA
JMFS112A02+ ACTCCGTACCTTAGAAACTTTTGGTAGAGAGCTGAGATTTATGGAGAGCGAGGGATGGAG
                      ____________________________________________________________
consensus ACTCCGTACCTTAGAAACTTTTGGTAGAGAGCTGAGATTTATGGAGAGCGAGGGATGGAG