Previous Contig 003786:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111D01Sequence617003786 (2)gb:AP003295_18275222e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069
JMSF034C07Sequence653003786 (2)gb:AP003295_18275222e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069737023604gb:BT012284_16414902e-07Arabidopsis thaliana At3g26932 gene, complete cds.>gb:AP000602_1820391 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034C07+ CCTACTTTTGTGTTTGGAG
                      ____________________________________________________________
consensus CCTACTTTTGTGTTTGGAG
 
. : . : . : . : . : . :
JMSF034C07+ TAGAAGCCTCTGTAAAGCTTTTTGGTGGAAGAGATGGAGGGGTTTGCTGCAGCAGAGGAG
                      ____________________________________________________________
consensus TAGAAGCCTCTGTAAAGCTTTTTGGTGGAAGAGATGGAGGGGTTTGCTGCAGCAGAGGAG
 
. : . : . : . : . : . :
JMSF034C07+ GACAAACAGGTTGGGGGCCAGCAAGCCAAGCTGAATTTGGGATTTGTCCGAATTGAGGGG
                      ____________________________________________________________
consensus GACAAACAGGTTGGGGGCCAGCAAGCCAAGCTGAATTTGGGATTTGTCCGAATTGAGGGG
 
. : . : . : . : . : . :
JMSF034C07+ GGGGAAGGGACGAATCGGCGACGAGGTGAACCGGAGATGGTTGTAAAGGCGGGGACAGAG
                      ____________________________________________________________
consensus GGGGAAGGGACGAATCGGCGACGAGGTGAACCGGAGATGGTTGTAAAGGCGGGGACAGAG
 
. : . : . : . : . : . :
JMSF034C07+ ACTGAAGAACGGGGGCGACAACCGGATCTGGCGGCCTAGTTGCCAATTGCTGGGGATGGG
                      ____________________________________________________________
consensus ACTGAAGAACGGGGGCGACAACCGGATCTGGCGGCCTAGTTGCCAATTGCTGGGGATGGG
 
. : . : . : . : . : . :
JMSF034C07+ CAGAGTGAAGCGCGGGCGGATTGGCAGTAAAATACTCAAAGGCAAAGCGAGAGGCGAGGT
JMFS111D01+ GTGAAGCGCGGGCGGATTGGCAGTAAAATACTCAAAGGCAAAGCGAGAGGCGAGGT
                      ____________________________________________________________
consensus CAGAGTGAAGCGCGGGCGGATTGGCAGTAAAATACTCAAAGGCAAAGCGAGAGGCGAGGT
 
. : . : . : . : . : . :
JMSF034C07+ TCTGAGCATCCTTAGCGGAGCGGCACTGATTCGGCGGCGACTGAAAAGAAATTCCAATTA
JMFS111D01+ TCTGAGCATCCTTAGCGGAGCGGCACTGATTCGGCGGCGACTGAAAAGAAATTCCAATTA
                      ____________________________________________________________
consensus TCTGAGCATCCTTAGCGGAGCGGCACTGATTCGGCGGCGACTGAAAAGAAATTCCAATTA
 
. : . : . : . : . : . :
JMSF034C07+ CGGTGACGGTGGCGGTGAATCGTGCGTCGTGATCGGGACCGACCTTCACCGAGGTGTACT
JMFS111D01+ CGGTGACGGTGGCGGTGAATCGTGCGTCGTGATCGGGACCGACCTTCACCGAGGTGTACT
                      ____________________________________________________________
consensus CGGTGACGGTGGCGGTGAATCGTGCGTCGTGATCGGGACCGACCTTCACCGAGGTGTACT
 
. : . : . : . : . : . :
JMSF034C07+ CCGGCAACGCCACCAAGTAGCGTTGGCACAACTCTTGCAGCTTCGACTTGTACATTCTTC
JMFS111D01+ CCGGCAACGCCACCAAGTAGCGTTGGCACAACTCTTGCAGCTTCGACTTGTACATTCTTC
                      ____________________________________________________________
consensus CCGGCAACGCCACCAAGTAGCGTTGGCACAACTCTTGCAGCTTCGACTTGTACATTCTTC
 
. : . : . : . : . : . :
JMSF034C07+ AATTCGTCACACTCACTCAGGTTTTCCTCTGCACTGCACTGCACTGCACTGCTATGCTGA
JMFS111D01+ AATTCGTCACACTCACTCAGGTTTTCCTCTGCACTGCACTGCACTGCACTGCTATGCTGA
                      ____________________________________________________________
consensus AATTCGTCACACTCACTCAGGTTTTCCTCTGCACTGCACTGCACTGCACTGCTATGCTGA
 
. : . : . : . : . : . :
JMSF034C07+ TGTCGTTTCCGAGGTTCTTTCAATTTCATTTGGATTCCTTTCCTGTTTTATAACTCGCAC
JMFS111D01+ TGTCGTTTCCGAGGTTCTTTCAATTTCATTTGGATTCCTTTCCTGTTTTATAACTCGCAC
                      ____________________________________________________________
consensus TGTCGTTTCCGAGGTTCTTTCAATTTCATTTGGATTCCTTTCCTGTTTTATAACTCGCAC
 
. : . : . : . : . : . :
JMSF034C07+ ATATTCAAAGCCACGCTGGATATGAGCAAGAT
JMFS111D01+ ATATTCAAAGCCACGCTGGATATGAGCAAGATTACGAGGAGTAACTGTATGTACAATGTA
                      ____________________________________________________________
consensus ATATTCAAAGCCACGCTGGATATGAGCAAGATTACGAGGAGTAACTGTATGTACAATGTA