Previous Contig 003783:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS071C10Sequence614003783 (2)pir|T45912|T459124e-47hypothetical protein F5K20.20 - Arabidopsis thaliana>gb:ATF5K20_1550776 Arabidop
JMFS111A11Sequence603003783 (2)pir|T45912|T459124e-44hypothetical protein F5K20.20 - Arabidopsis thaliana>gb:ATF5K20_1550776 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS071C10+ AGCAGTTAAGCTCCGCCAGAATGCGA
JMFS111A11+ CGA
                      ____________________________________________________________
consensus AGCAGTTAAGCTCCGCCAGAATGCGA
 
. : . : . : . : . : . :
JMFS071C10+ GCCAGCACGGGGAAGNCGGTGATGGAGAGAGCAACTCCCATGAAGACCGAGTATGGAGCG
JMFS111A11+ GCCAGCACGGGGAAGCCGGTGATGGAGAGAGCAACTCCCATGAAGACCGAGTATGGAGCG
                      ____________________________________________________________
consensus GCCAGCACGGGGAAGCCGGTGATGGAGAGAGCAACTCCCATGAAGACCGAGTATGGAGCG
 
. : . : . : . : . : . :
JMFS071C10+ AAGCCGACTTCATCGGCGCCTTGGACAACTCGCCGGAAAAGGAAAGTTATTCCAATGCCG
JMFS111A11+ AAGCCGACTTCATCGGCGCCTTGGACAACTCGCCGGAAAAGGAAAGTTATTCCAATGCCG
                      ____________________________________________________________
consensus AAGCCGACTTCATCGGCGCCTTGGACAACTCGCCGGAAAAGGAAAGTTATTCCAATGCCG
 
. : . : . : . : . : . :
JMFS071C10+ AAGACGAAAGGGAGGGATATTCCGGCCGCCGCTATGCAAAACGCACTTTTCCCATTTCTT
JMFS111A11+ AAGACGAAAGGGAGGGATATTCCGGCCGCCGCTATGCAAAACGCACTTTTCCCATTTCTT
                      ____________________________________________________________
consensus AAGACGAAAGGGAGGGATATTCCGGCCGCCGCTATGCAAAACGCACTTTTCCCATTTCTT
 
. : . : . : . : . : . :
JMFS071C10+ CGAAGGGAAGACAAGTCGAGCTCAAGGCCGACCAAGAAAAGATAGAAGAGTAGCCCAATG
JMFS111A11+ CGAAGGGAAGACAAGTCGAGCTCAAGGCCGACCAAGAAAAGATAGAAGAGTAGCCCAATG
                      ____________________________________________________________
consensus CGAAGGGAAGACAAGTCGAGCTCAAGGCCGACCAAGAAAAGATAGAAGAGTAGCCCAATG
 
. : . : . : . : . : . :
JMFS071C10+ CTTGACACTGATTCAAGAATTGGTGCACTCCATTCAGGAAATATAGTTTGCATGTATTCT
JMFS111A11+ CTTGACACTGATTCAAGAATTGGTGCACTCCATTCAGGAAATATAGTTTGCATGTATTCT
                      ____________________________________________________________
consensus CTTGACACTGATTCAAGAATTGGTGCACTCCATTCAGGAAATATAGTTTGCATGTATTCT
 
. : . : . : . : . : . :
JMFS071C10+ TGATTTCTTCCAAAAGCAGATGGCCCTAGGATAACCCCACCTAGAATTTCAGCGATGACT
JMFS111A11+ TGATTTCTTCCAAAAGCAGATGGCCCTAGGATAACCCCACCTAGAATTTCAGCGATGACT
                      ____________________________________________________________
consensus TGATTTCTTCCAAAAGCAGATGGCCCTAGGATAACCCCACCTAGAATTTCAGCGATGACT
 
. : . : . : . : . : . :
JMFS071C10+ TTGGGTTGTCGAAGGGGTTTGAGTAGGAAGGCGAAGAAGCGGCTAACAACGATGACTAGG
JMFS111A11+ TTGGGTTGTCGAAGGGGTTTGAGTAGGAAGGCGAAGAAGCGGCTAACAACGATGACTAGG
                      ____________________________________________________________
consensus TTGGGTTGTCGAAGGGGTTTGAGTAGGAAGGCGAAGAAGCGGCTAACAACGATGACTAGG
 
. : . : . : . : . : . :
JMFS071C10+ GTGGTTTGTACAATCAACAATGGCAATGCAAAATTAAGGGGATTTTGGCCCTGCCATGCT
JMFS111A11+ GTGGTTTGTACAATCAACAATGGCAATGCAAAATTAAGGGGATTTTGGCCCTGCCATGCT
                      ____________________________________________________________
consensus GTGGTTTGTACAATCAACAATGGCAATGCAAAATTAAGGGGATTTTGGCCCTGCCATGCT
 
. : . : . : . : . : . :
JMFS071C10+ CCATCCGATGATGTTTTTATTGCTGTCATGTTGTTCATCATCGCCATTTTTTTTTTTAAT
JMFS111A11+ CCATCCGATGATGTTTTTATTGCTGTCATGTTGTTCATCATCGCCATTTTTTTTTTTAAT
                      ____________________________________________________________
consensus CCATCCGATGATGTTTTTATTGCTGTCATGTTGTTCATCATCGCCATTTTTTTTTTTAAT
 
. : . : . : . : . : . :
JMFS071C10+ AATAATATAAAATGAACTTGCTAGTCTCTACACCAAAAAAGGGTGAGG
JMFS111A11+ AATAATATAAAATGAACTTGCTAGTCTCTACACCAAAAAAGGGTGAGGCATAAAACGAAG
                      ____________________________________________________________
consensus AATAATATAAAATGAACTTGCTAGTCTCTACACCAAAAAAGGGTGAGGCATAAAACGAAG