Previous Contig 003782:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111A06Sequence622003782 (2)gb:AY062727_15653832e-88Arabidopsis thaliana putative protein (At4g27640; T29A15.130) mRNA, complete cds
JMSF004E09Sequence451003782 (2)gb:AY062727_15653837e-61Arabidopsis thaliana putative protein (At4g27640; T29A15.130) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111A06+ AACTGACTTCAGAGCAGCAACC
                      ____________________________________________________________
consensus AACTGACTTCAGAGCAGCAACC
 
. : . : . : . : . : . :
JMFS111A06+ CTAACACGACTGCTAATTTCATCTTGAAGGCACTTAAGCAGCAGTGACTGTAAGTCAGTA
                      ____________________________________________________________
consensus CTAACACGACTGCTAATTTCATCTTGAAGGCACTTAAGCAGCAGTGACTGTAAGTCAGTA
 
. : . : . : . : . : . :
JMFS111A06+ AAATATGGACGAAAAGAATTCCCTATTGTTTCGGTTAAGGAGCTGAAAAGTATCAAGGCA
                      ____________________________________________________________
consensus AAATATGGACGAAAAGAATTCCCTATTGTTTCGGTTAAGGAGCTGAAAAGTATCAAGGCA
 
. : . : . : . : . : . :
JMSF004E09+ TGAGGACTTTGACTGCACTGAAATAAGAATGGCAACAGATCA
JMFS111A06+ ACTTCTCTGTGGTCTTCTTGAGGACTTTGACTGCACTGAAATAAGAATGGCAACAGATCA
                      ____________________________________________________________
consensus ACTTCTCTGTGGTCTTCTTGAGGACTTTGACTGCACTGAAATAAGAATGGCAACAGATCA
 
. : . : . : . : . : . :
JMSF004E09+ GGCCATTCACCAGCTGGAACTGCATACTTTGCAATAATACTCACCACATTAGCACTGGCT
JMFS111A06+ GGCCATTCACCAGCTGGAACTGCATACTTTGCAATAATACTCACCACATTAGCACTGGCT
                      ____________________________________________________________
consensus GGCCATTCACCAGCTGGAACTGCATACTTTGCAATAATACTCACCACATTAGCACTGGCT
 
. : . : . : . : . : . :
JMSF004E09+ CGCCTAACAGGCGCACTGTGCTCCACAGTGATGCTGTCAATTAAGGACTGCTTGACAAGC
JMFS111A06+ CGCCTAACAGGCGCACTGTGCTCCACAGTGATGCTGTCAATTAAGGACTGCTTGACAAGC
                      ____________________________________________________________
consensus CGCCTAACAGGCGCACTGTGCTCCACAGTGATGCTGTCAATTAAGGACTGCTTGACAAGC
 
. : . : . : . : . : . :
JMSF004E09+ TGACGGAGCTGAGGAGAAAGCTTGCCCCAATGGCCGGTGATCTTCTTGCGTAGGAGGACG
JMFS111A06+ TGACGGAGCTGAGGAGAAAGCTTGCCCCAATGGCCGGTGATCTTCTTGCGTAGGAGGACG
                      ____________________________________________________________
consensus TGACGGAGCTGAGGAGAAAGCTTGCCCCAATGGCCGGTGATCTTCTTGCGTAGGAGGACG
 
. : . : . : . : . : . :
JMSF004E09+ GCGGCGAGCTGGCGGACGTTGGGCGTCTTGGCGGTACGTAAGTGGTGAATTAGGGCGGGA
JMFS111A06+ GCGGCGAGCTGGCGGACGTTGGGCGTCTTGGCGGTACGTAAGTGGTGAATTAGGGCGGGG
                      ____________________________________________________________
consensus GCGGCGAGCTGGCGGACGTTGGGCGTCTTGGCGGTACGTAAGTGGTGAATTAGGGCGGGG
 
. : . : . : . : . : . :
JMSF004E09+ ACCACCTGCGGATCCTTTGCAAGCCGCTTTATCTGGTCCTCCGCCTGCCTCCGGGCGTCA
JMFS111A06+ ACCACCTGCGGATCCTTTGCAAGCCGCTTTATCTGGTCCTCCGCCTGCCTCCGGGCGTCA
                      ____________________________________________________________
consensus ACCACCTGCGGATCCTTTGCAAGCCGCTTTATCTGGTCCTCCGCCTGCCTCCGGGCGTCA
 
. : . : . : . : . : . :
JMSF004E09+ TTGTCCGGCATCAGAAACTGAATAAGCAATAACTCCAATGACTGCGCCATCGCTTCCTCT
JMFS111A06+ TTGTCCGGCATCAGAAACTGAATAAGCAATAACTCCAATGACTGCGCCATCGCTTCCTCT
                      ____________________________________________________________
consensus TTGTCCGGCATCAGAAACTGAATAAGCAATAACTCCAATGACTGCGCCATCGCTTCCTCT
 
. : . : . : . : . : . :
JMSF004E09+ CAAACTCTCCGCCGGCTTCTCTTTGTTAGTGTATAAAAC
JMFS111A06+ CAAACTCTCCGCCGGCTTCTCTTTGTTAGTGTATAAAACNCCTGCGGCTGAGCTGAGTGA
                      ____________________________________________________________
consensus CAAACTCTCCGCCGGCTTCTCTTTGTTAGTGTATAAAACNCCTGCGGCTGAGCTGAGTGA