Previous Contig 003780:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN019A03Sequence469003780 (2)
JMFS110G03Sequence642003780 (2)gb:AY093090_15750442e-11Arabidopsis thaliana unknown protein (At5g35980At5g35990) mRNA, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019A03+ CCXXXXXXXXX
                      ____________________________________________________________
consensus CCNNNNNNNNN
 
. : . : . : . : . : . :
JMFN019A03+ XXXXXXXXXXXXXXXXXXXXXXXCTGATAAGGTAACTAATTCCACTTCACAAACCCTTCA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNCTGATAAGGTAACTAATTCCACTTCACAAACCCTTCA
 
. : . : . : . : . : . :
JMFN019A03+ TAAAACAGCAACCAATCACTGCTTCATATTGTCCTATTGATATATAATATCTGTTTTTTT
                      ____________________________________________________________
consensus TAAAACAGCAACCAATCACTGCTTCATATTGTCCTATTGATATATAATATCTGTTTTTTT
 
. : . : . : . : . : . :
JMFN019A03+ TTTTTTGGATTTTCTGGATAAAAACAAGAGCAGGACATGACAAGAATGAATACTGCATAA
                      ____________________________________________________________
consensus TTTTTTGGATTTTCTGGATAAAAACAAGAGCAGGACATGACAAGAATGAATACTGCATAA
 
. : . : . : . : . : . :
JMFN019A03+ TCCCAGGTCTTTAGAACCTGGACTTTAGTTTTACAGAGAGAGTGGCCAAGTTGAAACAGT
                      ____________________________________________________________
consensus TCCCAGGTCTTTAGAACCTGGACTTTAGTTTTACAGAGAGAGTGGCCAAGTTGAAACAGT
 
. : . : . : . : . : . :
JMFN019A03+ GATCAAAGACCTCACTACACTACATTTAAAGAAGTCTTCATTCCATCAGCCATCACCAGC
JMFS110G03+ ACTACATTTAAAGAAGTCTTCATTCCATCAGCCATCACCAGC
                      ____________________________________________________________
consensus GATCAAAGACCTCACTACACTACATTTAAAGAAGTCTTCATTCCATCAGCCATCACCAGC
 
. : . : . : . : . : . :
JMFN019A03+ CAAGCTTCATCCAAACCCGCCAAGCACCATCGAGGCCTGATCTAATAGTTCCCAATAAAT
JMFS110G03+ CAAGCTTCATCCAAACCCGCCAAGCACCATCGAGGCCTGATCTAATAGTTCCCAATAAAT
                      ____________________________________________________________
consensus CAAGCTTCATCCAAACCCGCCAAGCACCATCGAGGCCTGATCTAATAGTTCCCAATAAAT
 
. : . : . : . : . : . :
JMFN019A03+ AAAATCTTGAAGGAAACACCACCACCACCACCCTGTATAATAGGTCATTAGAAGCCGGAG
JMFS110G03+ AAAATCTTGAAGGAAACACCACCACCACCACCCTGTATAATAGGTCATTAGAAGCCGGAG
                      ____________________________________________________________
consensus AAAATCTTGAAGGAAACACCACCACCACCACCCTGTATAATAGGTCATTAGAAGCCGGAG
 
. : . : . : . : . : . :
JMFN019A03+ TCCAGACATACGAGGAGCATAAACTAGGCAACTGCAAC
JMFS110G03+ TCCAGACATACGAGGAGCATAAACTAGGCAACTGCAACCACATGACCGGAAGATAAAGGT
                      ____________________________________________________________
consensus TCCAGACATACGAGGAGCATAAACTAGGCAACTGCAACCACATGACCGGAAGATAAAGGT
 
. : . : . : . : . : . :
JMFS110G03+ GGGATCTTGAATTACATTTACACGAGCAAATATGAAGAGAGATTGACTTTGGATCCATAA
                      ____________________________________________________________
consensus GGGATCTTGAATTACATTTACACGAGCAAATATGAAGAGAGATTGACTTTGGATCCATAA
 
. : . : . : . : . : . :
JMFS110G03+ GTGAAGTGCGAGAGGGCAGGTACAACCATAGTTAAATGTGGTCTTGCCAGCTCCTATCAA
                      ____________________________________________________________
consensus GTGAAGTGCGAGAGGGCAGGTACAACCATAGTTAAATGTGGTCTTGCCAGCTCCTATCAA
 
. : . : . : . : . : . :
JMFS110G03+ TATGTCCCCTATAGTTGGATACAAGCTACTTAGACCATTCTTCCATAATCTTTTCTTGCG
                      ____________________________________________________________
consensus TATGTCCCCTATAGTTGGATACAAGCTACTTAGACCATTCTTCCATAATCTTTTCTTGCG
 
. : . : . : . : . : . :
JMFS110G03+ CGGGAAGTAGGTGGAATGTTTGAAGCAGAGAAGTTGCCTCTACGGCCCCATGATGCCCCA
                      ____________________________________________________________
consensus CGGGAAGTAGGTGGAATGTTTGAAGCAGAGAAGTTGCCTCTACGGCCCCATGATGCCCCA
 
. : . : . : . : . : . :
JMFS110G03+ TTGGTTTCAGAAGGATAATCCTCGGAGCTAAAGTTGGAATGAGGAGCATGAGCCTTATTA
                      ____________________________________________________________
consensus TTGGTTTCAGAAGGATAATCCTCGGAGCTAAAGTTGGAATGAGGAGCATGAGCCTTATTA
 
. : . : . : . : . : . :
JMFS110G03+ TGGTAATCATTGCCACGAATAGCTGCCAATCTCCCTTGGTTAAACCGATGAACAGGCTGT
                      ____________________________________________________________
consensus TGGTAATCATTGCCACGAATAGCTGCCAATCTCCCTTGGTTAAACCGATGAACAGGCTGT
 
. : . : . : . : . : . :
JMFS110G03+ TGCGAAAACCGGCTTGGAGAACTTTGTGCAAGGTGTGGCAGAAAATATAATGGTTTTGCC
                      ____________________________________________________________
consensus TGCGAAAACCGGCTTGGAGAACTTTGTGCAAGGTGTGGCAGAAAATATAATGGTTTTGCC