Previous Contig 003777:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS107G08Sequence618003777 (2)pir|F90073|F900730.014hypothetical protein SA2447 [imported] - Staphylococcus aureus (strain N315)>gb:
JMFS110D04Sequence629003777 (2)pir|F90073|F900730.015hypothetical protein SA2447 [imported] - Staphylococcus aureus (strain N315)>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107G08+ CAGGA
                      ____________________________________________________________
consensus CAGGA
 
. : . : . : . : . : . :
JMFS107G08+ CAGATATCGGTTCTTCTGGAAGTTTCAGCGTGTCTGAGTTAGAATTACTGGGTAACGAAG
JMFS110D04+ GTCTGAGTTAGAATTACTGGGTAACGAAG
                      ____________________________________________________________
consensus CAGATATCGGTTCTTCTGGAAGTTTCAGCGTGTCTGAGTTAGAATTACTGGGTAACGAAG
 
. : . : . : . : . : . :
JMFS107G08+ GTGAGGCATCTTGTATAATTGCAGGGTCTTGGGTATGAGCAGCGGGGAGAGAACCGGAAT
JMFS110D04+ GTGAGGCATCTTGTATAATTGCAGGGTCTTGGGTATGAGCAGCGGGGAGAGAACCGGAAT
                      ____________________________________________________________
consensus GTGAGGCATCTTGTATAATTGCAGGGTCTTGGGTATGAGCAGCGGGGAGAGAACCGGAAT
 
. : . : . : . : . : . :
JMFS107G08+ CACTTGGCTTTGCATCTAAGACGGATAAAGGAAGGGATTCTGGGAGAGCCGTAGAATTTT
JMFS110D04+ CACTTGGCTTTGCATCTAAGACGGATAAAGGAAGGGATTCTGGGAGAGCCGTAGAATTTT
                      ____________________________________________________________
consensus CACTTGGCTTTGCATCTAAGACGGATAAAGGAAGGGATTCTGGGAGAGCCGTAGAATTTT
 
. : . : . : . : . : . :
JMFS107G08+ CATCTCTGCGACGCTCCAATGGTTCTGGATTCTCTGGTAGTGGAAGTAATGCTTCCAGTT
JMFS110D04+ CATCTCTGCGACGCTCCAATGGTTCTGGATTCTCTGGTAGTGGAAGTAATGCTTCCAGTT
                      ____________________________________________________________
consensus CATCTCTGCGACGCTCCAATGGTTCTGGATTCTCTGGTAGTGGAAGTAATGCTTCCAGTT
 
. : . : . : . : . : . :
JMFS107G08+ GGGGAGATTCAGTTTCAAATGTTATAATACCCGTTTCGCTTTCATTGACCGGAGAAGAAG
JMFS110D04+ GGGGAGATTCAGTTTCAAATGTTATAATACCCGTTTCGCTTTCATTGACCGGAGAAGAAG
                      ____________________________________________________________
consensus GGGGAGATTCAGTTTCAAATGTTATAATACCCGTTTCGCTTTCATTGACCGGAGAAGAAG
 
. : . : . : . : . : . :
JMFS107G08+ TTGAAATAATCAAATTTCCCGATGGAGAAGGTTGATCCTCTTCCAGGTATCCACCGCCAT
JMFS110D04+ TTGAAATAATCAAATTTCCCGATGGAGAAGGTTGATCCTCTTCCAGGTATCCACCGCCAT
                      ____________________________________________________________
consensus TTGAAATAATCAAATTTCCCGATGGAGAAGGTTGATCCTCTTCCAGGTATCCACCGCCAT
 
. : . : . : . : . : . :
JMFS107G08+ CATCATGCTCGGCTTTACAACTATCTGAAGCCTGCATTTCATGGCTCATTTTTCCATCGA
JMFS110D04+ CATCATGCTCGGCTTTACAACTATCTGAAGCCTGCATTTCATGGCTCATTTTTCCATCGA
                      ____________________________________________________________
consensus CATCATGCTCGGCTTTACAACTATCTGAAGCCTGCATTTCATGGCTCATTTTTCCATCGA
 
. : . : . : . : . : . :
JMFS107G08+ TGTTTTCGCTCGTCTCAGATGCTGCACCGTTTGCCCGATCCTCGTTCAGTATAGAAGCCT
JMFS110D04+ TGTTTTCGCTCGTCTCAGATGCTGCACCGTTTGCCCGATCCTCGTTCAGTATAGAAGCCT
                      ____________________________________________________________
consensus TGTTTTCGCTCGTCTCAGATGCTGCACCGTTTGCCCGATCCTCGTTCAGTATAGAAGCCT
 
. : . : . : . : . : . :
JMFS107G08+ CAGATACAATAGAGCATTCTGACGGACCATTTTCCTTCATACTTTTCACATCCTCCATTC
JMFS110D04+ CAGATACAATAGAGCATTCTGACGGACCATTTTCCTTCATACTTTTCACATCCTCCATTC
                      ____________________________________________________________
consensus CAGATACAATAGAGCATTCTGACGGACCATTTTCCTTCATACTTTTCACATCCTCCATTC
 
. : . : . : . : . : . :
JMFS107G08+ AAGAAACAGCTAAGGTGAACCAAGTTGTGACGAGAATCCAGGAATCAGTGGAAGCACCAC
JMFS110D04+ AAGAAACAGCTAAGGTGAACCAAGTTGTGACGAGAATCCAGGAATCAGTGGAAGCACCAC
                      ____________________________________________________________
consensus AAGAAACAGCTAAGGTGAACCAAGTTGTGACGAGAATCCAGGAATCAGTGGAAGCACCAC
 
. : . : . : . : . : . :
JMFS107G08+ AGAGAAGTCAAAA
JMFS110D04+ AGAGAAGTCAAAATTCTGACGCTGCAAATGAATCCGCCTCTGTGTCTGGGTGTCTCTGAC
                      ____________________________________________________________
consensus AGAGAAGTCAAAATTCTGACGCTGCAAATGAATCCGCCTCTGTGTCTGGGTGTCTCTGAC