Previous Contig 003776:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041F12Sequence503003776 (36)gb:AC007048_15351001e-30Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS006D06Sequence561003776 (36)gb:AC007048_15351002e-44Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS006G02Sequence590003776 (36)gb:AC007048_15351001e-46Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS009H03Sequence574003776 (36)gb:AC007048_15351001e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS013H06Sequence634003776 (36)gb:AC007048_15351002e-51Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS019D08Sequence582003776 (36)gb:AC007048_15351002e-44Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS025A02Sequence620003776 (36)gb:AC007048_15351001e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS026F09Sequence630003776 (36)gb:AC007048_15351001e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS030F08Sequence591003776 (36)gb:AC007048_15351001e-67Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS041B06Sequence641003776 (36)gb:AC007048_15351005e-53Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS051F06Sequence629003776 (36)gb:AC007048_15351001e-48Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS053B03Sequence619003776 (36)gb:AC007048_15351006e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS053D02Sequence560003776 (36)gb:AC007048_15351007e-42Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS055E05Sequence616003776 (36)gb:AC007048_15351001e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS069G12Sequence609003776 (36)gb:AC007048_15351002e-44Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS074E05Sequence627003776 (36)gb:AC007048_15351004e-56Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS081B01Sequence627003776 (36)gb:AC007048_15351001e-42Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS085B01Sequence595003776 (36)gb:AC007048_15351004e-65Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS090B04Sequence612003776 (36)gb:AC007048_15351009e-39Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS101D01Sequence619003776 (36)gb:AC007048_15351004e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS107D10Sequence626003776 (36)gb:AC007048_15351003e-52Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS107G07Sequence620003776 (36)gb:AC007048_15351002e-53Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS109C06Sequence627003776 (36)gb:AC007048_15351004e-55Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS110C11Sequence627003776 (36)gb:AC007048_15351001e-43Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS112D10Sequence626003776 (36)gb:AC007048_15351003e-52Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS117E02Sequence551003776 (36)gb:AC007048_15351001e-34Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS126B12Sequence626003776 (36)gb:AC007048_15351005e-54Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS129F07Sequence608003776 (36)gb:AC007048_15351001e-49Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS137F04Sequence600003776 (36)gb:AC007048_15351005e-45Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS139D09Sequence626003776 (36)gb:AC007048_15351001e-51Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS139H03Sequence613003776 (36)gb:AC007048_15351004e-55Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS147B03Sequence618003776 (36)gb:AC007048_15351005e-50Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS165D06Sequence629003776 (36)gb:AC007048_15351004e-55Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMFS167C08Sequence625003776 (36)gb:AC007048_15351001e-43Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMSF013C16Sequence453003776 (36)gb:AC007048_15351007e-21Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:697003512 (4)gb:AC007048_15351001e-61Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:
JMSF013M04Sequence509003776 (36)gb:AC007048_15351002e-28Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:700003512 (4)gb:AC007048_15351003e-60Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS030F08+ AGCAAGGATGTAA
                      ____________________________________________________________
consensus AGCAAGGATGTAA
 
. : . : . : . : . : . :
JMFS030F08+ CAGAACTGCTTTTTCAGCAAAAGGTTGTCACAAGTTTTAAAAACATGCTTCACATACTGT
                      ____________________________________________________________
consensus CAGAACTGCTTTTTCAGCAAAAGGTTGTCACAAGTTTTAAAAACATGCTTCACATACTGT
 
. : . : . : . : . : . :
JMFS030F08+ GTGTTATCAAGGCGTAGTGCGATGAAAAGAGCACTTGCATATTCTCCAAATTTCGTATAA
                      ____________________________________________________________
consensus GTGTTATCAAGGCGTAGTGCGATGAAAAGAGCACTTGCATATTCTCCAAATTTCGTATAA
 
. : . : . : . : . : . :
JMFS030F08+ ATATTGTATGCAATGTCTAGTACCAAGGTGTCATCTGGACCTGGAAGATAATTAGCTGCA
                      ____________________________________________________________
consensus ATATTGTATGCAATGTCTAGTACCAAGGTGTCATCTGGACCTGGAAGATAATTAGCTGCA
 
. : . : . : . : . : . :
JMFS030F08+ CTCTGAAGGTATGAGCATGTCCTTTTATAATTTGCATGCTCTACATACTCAAGAAGAAGA
                      ____________________________________________________________
consensus CTCTGAAGGTATGAGCATGTCCTTTTATAATTTGCATGCTCTACATACTCAAGAAGAAGA
 
. : . : . : . : . : . :
JMFS030F08+ TCAAGATCTTCAACCTCCATTAAAAGGTCAACTGCCTCAGGTTCTGCATTATGCTTCATA
JMFS085B01+ ATTAAAAGGTCAACTGCCTCAGGTTCTGCATTATGCTTCATA
                      ____________________________________________________________
consensus TCAAGATCTTCAACCTCCATTAAAAGGTCAACTGCCTCAGGTTCTGCATTATGCTTCATA
 
. : . : . : . : . : . :
JMFS030F08+ TGGAAATGAACAATTTGTTGCACAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS085B01+ TGGAAATGAACAATTTGTTGCACAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS139H03+ CAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS074E05+ CAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS109C06+ CAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS165D06+ AAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS107G07+ CAAATCATCGATTGGGGCCTCTTCACCC
JMFS126B12+ CATCAAATCATCGATTGGGGCCTCTTCACCC
JMFS139D09+ CGATTGGGGCCTCTTCACCC
JMFS112D10+ CATCGATTGGGGCCTCTTCACCC
JMFS107D10+ ATCGATTGGGGCCTCTTCACCC
JMFS013H06+ TCATCGATTGGGGCCTCTTCACCC
JMFS055E05+ TCACCC
JMFS053B03+ TCACCC
JMFS129F07+ TCACCC
JMFS025A02+ TCACCC
JMFS147B03+ CTCTTCACCC
JMFS009H03+ TCACCC
JMFS041B06+ ATCATCGATTGGGGCCTCTTCACCC
JMFS051F06+ CTCTTCACCC
JMFS026F09+ TCACCC
                      ____________________________________________________________
consensus TGGAAATGAACAATTTGTTGCACAAGCTCCATCAAATCATCGATTGGGGCCTCTTCACCC
 
. : . : . : . : . : . :
JMFS030F08+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS085B01+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS139H03+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS074E05+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS109C06+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS165D06+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS107G07+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS126B12+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS139D09+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS112D10+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS107D10+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS013H06+ TGTCGTTTANCATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCNC
JMFS055E05+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS053B03+ TGTCGTTTANCATACTCNTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS129F07+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS053D02+ CCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS006D06+ CTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS090B04+ GCCC
JMFS006G02+ CCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS025A02+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS147B03+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS009H03+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS041B06+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS051F06+ TGTCGTTTTACATACTCNTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCG
JMFS101D01+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS026F09+ TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS019D08+ TCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS137F04+ TTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS069G12+ TCCCGCCAAGTTCCTTACATATTCATGGCCC
JMFS167C08+ CCGCCAAGTTCCTTACATATTCATGGCCC
JMFS081B01+ CCGCCAAGTTCCTTACATTTTCATGGCCC
JMFS110C11+ CGCCAAGTTCCTTACATATTCATGGCCC
                      ____________________________________________________________
consensus TGTCGTTTTACATACTCCTGAGCAATTTCTCCCGCCAAGTTCCTTACATATTCATGGCCC
 
. : . : . : . : . : . :
JMFS030F08+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS085B01+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS139H03+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS074E05+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS109C06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS165D06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS107G07+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS126B12+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS139D09+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS112D10+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS107D10+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS013H06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS055E05+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS053B03+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS129F07+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS053D02+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS006D06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS090B04+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS006G02+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFN041F12+ CCTTTCTCCT
JMFS025A02+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS147B03+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS009H03+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS041B06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS051F06+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS101D01+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS117E02+ CATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS026F09+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS019D08+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS137F04+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS069G12+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS167C08+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS081B01+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
JMFS110C11+ CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
                      ____________________________________________________________
consensus CAAGAACCAATATCATCATCACATCCAAGTAGTCTGTACTTCAAGCTCTCCCTTTCTCCT
 
. : . : . : . : . : . :
JMFS030F08+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS085B01+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS139H03+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS074E05+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS109C06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS165D06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS107G07+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS126B12+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS139D09+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS112D10+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS107D10+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS013H06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS055E05+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS053B03+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS129F07+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS053D02+ TCAACAGACATTGTCAATGCCAAAGCAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS006D06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS090B04+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS006G02+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFN041F12+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS025A02+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS147B03+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS009H03+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS041B06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS051F06+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS101D01+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS117E02+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS026F09+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS019D08+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS137F04+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMSF013M04+ CAACAGACATNGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS069G12+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS167C08+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS081B01+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
JMFS110C11+ TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
                      ____________________________________________________________
consensus TCAACAGACATTGTCAATGCCAAAACAGAAAGTATATATGCTAGTAGTTTCTTGGTATCT
 
. : . : . : . : . : . :
JMFS030F08+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCC
JMFS085B01+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS139H03+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS074E05+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS109C06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS165D06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS107G07+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS126B12+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS139D09+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS112D10+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS107D10+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS013H06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS055E05+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS053B03+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS129F07+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS053D02+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGAACGCAAGAACTTT
JMFS006D06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS090B04+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS006G02+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFN041F12+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS025A02+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS147B03+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS009H03+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS041B06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS051F06+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS101D01+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS117E02+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS026F09+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS019D08+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS137F04+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMSF013M04+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMSF013C16+ TGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS069G12+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS167C08+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS081B01+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
JMFS110C11+ GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
                      ____________________________________________________________
consensus GAATCTGGCATTTTCTCATAATGCAACTTTAGTGTTCCATAATGAGGACGCAAGAACTTT
 
. : . : . : . : . : . :
JMFS085B01+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS139H03+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS074E05+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS109C06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS165D06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS107G07+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS126B12+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS139D09+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS112D10+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS107D10+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS013H06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS055E05+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS053B03+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS129F07+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS053D02+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS006D06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS090B04+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS006G02+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFN041F12+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS025A02+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS147B03+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS009H03+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS041B06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS051F06+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS101D01+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS117E02+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS026F09+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS019D08+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS137F04+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMSF013M04+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMSF013C16+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS069G12+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS167C08+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS081B01+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
JMFS110C11+ AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
                      ____________________________________________________________
consensus AATGGCTTAGGAACTGATGTCATAGAGCTTGTTGCTGACCGAATTTCCTGCCTCATGCTC
 
. : . : . : . : . : . :
JMFS085B01+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS139H03+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS074E05+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS109C06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS165D06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS107G07+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS126B12+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS139D09+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS112D10+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS107D10+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS013H06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS055E05+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS053B03+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS129F07+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS053D02+ TATAGGGCAGCCATATGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS006D06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS090B04+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS006G02+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFN041F12+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS025A02+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS147B03+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS009H03+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS041B06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS051F06+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS101D01+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS117E02+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS026F09+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS019D08+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS137F04+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMSF013M04+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMSF013C16+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS069G12+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS167C08+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS081B01+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
JMFS110C11+ TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
                      ____________________________________________________________
consensus TCTAGGGCAGCCATCTGCAGCCCAGTCTCAGGGTCCTGAACTCGCTCTACGTACAACTCC
 
. : . : . : . : . : . :
JMFS085B01+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS139H03+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS074E05+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS109C06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS165D06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS107G07+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS126B12+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS139D09+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS112D10+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS107D10+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS013H06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS055E05+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS053B03+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS129F07+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS053D02+ ACACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATGTTCATCTTTCTTGTCGTCCTT
JMFS006D06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS090B04+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS006G02+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFN041F12+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAAAGATCTTCATCTTTCTTGTCGTCCTT
JMFS025A02+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS147B03+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS009H03+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS041B06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS051F06+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS101D01+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS117E02+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS026F09+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS019D08+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS137F04+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMSF013M04+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMSF013C16+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS069G12+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS167C08+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS081B01+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
JMFS110C11+ A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
                      ____________________________________________________________
consensus A-ACTGTTGTTTGAGTGCTAGATCCTCCTCGGAGAGATCTTCATCTTTCTTGTCGTCCTT
 
. : . : . : . : . : . :
JMFS085B01+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS139H03+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS074E05+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS109C06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS165D06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS107G07+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS126B12+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS139D09+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS112D10+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS107D10+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS013H06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS055E05+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS053B03+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS129F07+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS053D02+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS006D06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS090B04+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS006G02+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFN041F12+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS025A02+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS147B03+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTC--CTCTAGCTGGTTTATCACC
JMFS009H03+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS041B06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS051F06+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS101D01+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS117E02+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS026F09+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS019D08+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS137F04+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMSF013M04+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMSF013C16+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS069G12+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS167C08+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS081B01+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
JMFS110C11+ CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
                      ____________________________________________________________
consensus CTTCTTAGGGTCCTTGGCAGGGACTTTGACAGAGGCCTCCTCTCTAGCTGGTTTATCACC
 
. : . : . : . : . : . :
JMFS085B01+ TCCGGCGGCCCCGG
JMFS139H03+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS074E05+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS109C06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS165D06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS107G07+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS126B12+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS139D09+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS112D10+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS107D10+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS013H06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS055E05+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS053B03+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS129F07+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS053D02+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS006D06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS090B04+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS006G02+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFN041F12+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS025A02+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS147B03+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS009H03+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCC
JMFS041B06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS051F06+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS101D01+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS117E02+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS026F09+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS019D08+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS137F04+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMSF013M04+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMSF013C16+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS069G12+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS167C08+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS081B01+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
JMFS110C11+ TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
                      ____________________________________________________________
consensus TCCGGCGGCCCCGGCACTGTTTGGATCCGGCGTCATCGCTACTGAGATAACTAAACCCTA
 
. : . : . : . : . : . :
JMFS139H03+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAA
JMFS074E05+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGG
JMFS109C06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTC
JMFS165D06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAG
JMFS107G07+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAG
JMFS126B12+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCTG
JMFS139D09+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS112D10+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS107D10+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS013H06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS055E05+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS053B03+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS129F07+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGC
JMFS053D02+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTC
JMFS006D06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTC
JMFS090B04+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGC
JMFS006G02+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFN041F12+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS025A02+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS147B03+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS041B06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS051F06+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS101D01+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS117E02+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS026F09+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS019D08+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS137F04+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMSF013M04+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMSF013C16+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS069G12+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS167C08+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS081B01+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
JMFS110C11+ GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
                      ____________________________________________________________
consensus GCGACAGACAGAAGTCTCCGGTAAAAGGAAATTCAATAGCTTGGTGTTTCGAGCAAGCAA
 
. : . : . : . : . : . :
JMFS139D09+ GGTTTTC
JMFS112D10+ GGTT
JMFS107D10+ GGTTT
JMFS013H06+ GGTTTTCTTCG
JMFS055E05+ GGTTTTCTTCG
JMFS053B03+ GGTTTTCTTCGCCT
JMFS006G02+ GGTTTTC
JMFN041F12+ GGTTTTCTTCGCCT
JMFS025A02+ GGTTTTCTTCGCCTT
JMFS147B03+ GGTTTTCTTCG
JMFS041B06+ GGTTTTCTTCGCCTTTC
JMFS051F06+ GGTTTTCTTCGCCTTTCTCT
JMFS101D01+ GGTTTTCTTCGCCTTTCTCT
JMFS117E02+ GGTTTTCTTCGCCTTTCTCTGCTTC
JMFS026F09+ GGTTTTCTTCGCCTTTCTCTGCTTC
JMFS019D08+ GGTTTTCTTCGC
JMFS137F04+ GGTTTTCTTCGCCTTTCTCTGCTTCG
JMSF013M04+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTAC
JMSF013C16+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTT
JMFS069G12+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTTA
JMFS167C08+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTTAGTCTTCAATCATGTGCTT
JMFS081B01+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTTAGTCTTCAATCATGTGCTT
JMFS110C11+ GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTTAGTCTTCAATCATGTGCTTTCT
                      ____________________________________________________________
consensus GGTTTTCTTCGCCTTTCTCTGCTTCGCTACTTCTCTTTAGTCTTCAATCATGTGCTTTCT