Previous Contig 003764:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011E04Sequence612003764 (9)pir|A86153|A861532e-31hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops
JMFS026G09Sequence602003764 (9)pir|A86153|A861532e-31hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops
JMFS038D11Sequence602003764 (9)pir|A86153|A861538e-32hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops
JMFS109A10Sequence620003764 (9)pir|A86153|A861532e-31hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops
JMSF006A16Sequence271003764 (9)pir|A86153|A861531e-23hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops
JMSF008I13Sequence373003764 (9)pir|A86153|A861532e-20hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops139011449 (2)gb:AY059759_15646142e-04Arabidopsis thaliana putative bZIP protein (At3g60320) mRNA, complete cds.
JMSF017B02Sequence402003764 (9)pir|A86153|A861535e-17hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops184011934 (2)gb:AY059759_15646142e-10Arabidopsis thaliana putative bZIP protein (At3g60320) mRNA, complete cds.
JMSF023F09Sequence677003764 (9)gb:AY059759_15646142e-38Arabidopsis thaliana putative bZIP protein (At3g60320) mRNA, complete cds.134011449 (2)gb:AY059759_15646140.004Arabidopsis thaliana putative bZIP protein (At3g60320) mRNA, complete cds.
JMSF050K05Sequence703003764 (9)pir|A86153|A861533e-31hypothetical protein T7I23.5 - Arabidopsis thaliana>gb:AE005172_889258 Arabidops169011934 (2)gb:AY059759_15646142e-09Arabidopsis thaliana putative bZIP protein (At3g60320) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023F09+ CTCGGAGCTGGGAGGGAAGGAGGGTAGAAATTTTCCCAGTTCCAGACGGAGG
                      ____________________________________________________________
consensus CTCGGAGCTGGGAGGGAAGGAGGGTAGAAATTTTCCCAGTTCCAGACGGAGG
 
. : . : . : . : . : . :
JMSF023F09+ AGGCTTGTGAGGGAGTGCTGGAATAGGTTGAATTCGCTTTCGCGTCGTATGTATAGTTTT
JMSF050K05+ GGGAGTGCTGGAATAGGTTGAATTCGCTTTCGCGTCGTATGTATAGTTTT
                      ____________________________________________________________
consensus AGGCTTGTGAGGGAGTGCTGGAATAGGTTGAATTCGCTTTCGCGTCGTATGTATAGTTTT
 
. : . : . : . : . : . :
JMSF023F09+ CGTTTTCGAAGAAATTGTGGTTCCTTGGTGTAGCGGGGAAGCTCGATTCCGAGAGGATGT
JMFS026G09+ GGTTCCTTGGTGTAGCGGGGAAGCTCGATTCCGAGAGGATGT
JMFS038D11+ TTCCTTGGTGTAGCGGGGAAGCTCGATTCCGAGAGGATGT
JMFS011E04+ GGTTCCTTGGTGTAGCGGGGAAGCTCGATTCCGAGAGGATGT
JMSF050K05+ CGTTTTCGAAGAAATTGTGGTTCCTTGGTGTAGC-GGGAAGCTCGATTCCGAGAGGATGT
JMFS109A10+ AGCTCGATTCCGAGAGGATGT
                      ____________________________________________________________
consensus CGTTTTCGAAGAAATTGTGGTTCCTTGGTGTAGCGGGGAAGCTCGATTCCGAGAGGATGT
 
. : . : . : . : . : . :
JMSF023F09+ GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
JMFS026G09+ GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
JMFS038D11+ GAGGCAGTTTCACGGGCTTTTCCGGTGGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
JMFS011E04+ GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
JMSF050K05+ GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
JMFS109A10+ GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
                      ____________________________________________________________
consensus GAGGCAGTTTCACGGGCTTTTTCCGGTGGACTTGGGGTTGCCGCGGCTGGGAGGCGACGG
 
. : . : . : . : . : . :
JMSF023F09+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
JMFS026G09+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
JMFS038D11+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
JMFS011E04+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
JMSF050K05+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
JMFS109A10+ AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
                      ____________________________________________________________
consensus AGTAGTGTGGTGGTGGCGGGGGTTGGTGAATCGACGGAGATGGAGAAGGGATGCGAACCG
 
. : . : . : . : . : . :
JMSF023F09+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
JMFS026G09+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
JMFS038D11+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
JMFS011E04+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
JMSF050K05+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
JMFS109A10+ GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
                      ____________________________________________________________
consensus GCGGCGGCGGCGGAGGGGTTTTGAAGGTGGACGCGGAGGAAGGAGTGCGGACGAACACGG
 
. : . : . : . : . : . :
JMSF023F09+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMFS026G09+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMFS038D11+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMSF006A16+ GGCGGCGAAGGAANTCAGAGCAGAGC
JMFS011E04+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMSF050K05+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMSF017B02+ CCGAGACAGAGAGAGGCTNGCCGGCGGCGAAGGAAATCAGAGCAGAGC
JMSF008I13+ AAGGAAATCAGAGCAGAGC
JMFS109A10+ CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
                      ____________________________________________________________
consensus CGGGCGTCTCCTCCGAGACAGAGAGAGGCTCGCCGGCGGCGAAGGAAATCAGAGCAGAGC
 
. : . : . : . : . : . :
JMSF023F09+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMFS026G09+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMFS038D11+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMSF006A16+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMFS011E04+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMSF050K05+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMSF017B02+ CAGTTAGTTTAAGTGAGCGGCNGTAGTCAGAATGGGCGGCGGCTAAATGGTGGNGAGCAT
JMSF008I13+ CAGTTAGTTTAAGTGAGCGGCAGTANTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
JMFS109A10+ CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
                      ____________________________________________________________
consensus CAGTTAGTTTAAGTGAGCGGCAGTAGTCAGAATGGGCGGCGGCTAAATGGTGGCGAGCAT
 
. : . : . : . : . : . :
JMSF023F09+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMFS026G09+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMFS038D11+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMSF006A16+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMFS011E04+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMSF050K05+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMSF017B02+ ACACCGCCTCCTTCATCAGGNGGNGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMSF008I13+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
JMFS109A10+ ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
                      ____________________________________________________________
consensus ACACCGCCTCCTTCATCAGGCGGCGCCGCTCCTTGCACCGCCGGACAGTATCCTCGTTGT
 
. : . : . : . : . : . :
JMSF023F09+ CCAGCTTCGACGCCGTGCACCCCATGTCC
JMFS026G09+ CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
JMFS038D11+ CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
JMSF006A16+ CCAGCTTCGACGCCGTGCACCCCATGTCC
JMFS011E04+ CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
JMSF050K05+ CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAG-AAA
JMSF017B02+ CCAGNTTTGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
JMSF008I13+ CCAGATTTGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAG-AAA
JMFS109A10+ CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
                      ____________________________________________________________
consensus CCAGCTTCGACGCCGTGCACCCCATGTCCTGGTTAAACAAAATTCAAGTACAACAGAAAA
 
. : . : . : . : . : . :
JMFS026G09+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
JMFS038D11+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
JMFS011E04+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
JMSF050K05+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
JMSF017B02+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
JMSF008I13+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCANGGCGGT
JMFS109A10+ AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
                      ____________________________________________________________
consensus AAAAAACAACAACAACAAAAACGCAATATTTCCGCCGTCTCTCCCGTCGCGCACGGCGGT
 
. : . : . : . : . : . :
JMFS026G09+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
JMFS038D11+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAGAATGTACTCCCACTTCTTC
JMFS011E04+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
JMSF050K05+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
JMSF017B02+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
JMSF008I13+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTNTTC
JMFS109A10+ CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
                      ____________________________________________________________
consensus CGAAACGGCCGTACCGGAGCTGTTGGCGGTGGTGGGGGAAG-ATGTACTCCCACTTCTTC
 
. : . : . : . : . : . :
JMFS026G09+ TTCACAAGTTCACAGTGTGTT
JMFS038D11+ TTCACAAGTTCACAGTGTGTTC
JMFS011E04+ TTCACAAGTTCACAGTGTGTTCTTGACTTGA
JMSF050K05+ TTCACAAGTTCACAGTGTGTTCTTGACTTGACTTCTCATCAGTTTGCGTCTGCCC
JMSF017B02+ TTCACAAGTTCACAGTGTGTTCTTGACTTGACTTCTCATCAGTTTGCGTCTGCCC
JMSF008I13+ TTCACAAGTTCACAGTGTGTTCTTGACTTGACTTCTCATCAGTTTGCGTCTGCCC
JMFS109A10+ TTCACAAGTTCACAGTGTGTTCTTGACTTGACTTCTCATCAGTTTGCGTCTGCCCATTAC
                      ____________________________________________________________
consensus TTCACAAGTTCACAGTGTGTTCTTGACTTGACTTCTCATCAGTTTGCGTCTGCCCATTAC