Previous Contig 003761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D06Sequence487009981 (13)gb:AB117995_15277995e-11Oryza sativa (japonica cultivar-group) bip108 mRNA for BRI1-KD interacting prote732003761 (3)gb:AY087044_15720801e-69Arabidopsis thaliana clone 30996 mRNA, complete sequence.
JMFN011I02Sequence590003761 (3)gb:AY087044_15720805e-63Arabidopsis thaliana clone 30996 mRNA, complete sequence.
JMFS108F10Sequence627003761 (3)gb:AE016959_10210472e-71Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008D06- ATAATTTAT
                      ____________________________________________________________
consensus ATAATTTAT
 
. : . : . : . : . : . :
JMFN011I02+ TTTATAATGTAATTTAATAAAATGCATTGAAAACTTAA
rJMFF008D06- AATGTTTTTTGATACACAGTAATTTATAATGTAATTTAATAAAATGCATTGAAAACTTAA
                      ____________________________________________________________
consensus AATGTTTTTTGATACACAGTAATTTATAATGTAATTTAATAAAATGCATTGAAAACTTAA
 
. : . : . : . : . : . :
JMFN011I02+ AATTTTTGCTTCAATATAATGTTCGCCAATTTCCTGAGAAAATGCATCAAATTAAAGACG
rJMFF008D06- AATTTTTGCTTCAATATAATGTTCGCCAATTTCCTGAGAAAATGCATCAAATTAAAGACG
                      ____________________________________________________________
consensus AATTTTTGCTTCAATATAATGTTCGCCAATTTCCTGAGAAAATGCATCAAATTAAAGACG
 
. : . : . : . : . : . :
JMFN011I02+ AAGAAGACAACGCAATGATTTTCCTTCAATAAGCAACTGGAAGGCGTCATTTATTTGCTG
rJMFF008D06- AAGAAGACAACGCAATGATTTTCCTTCAATAAGCAACTGGAAGGCGTCATTTATTTGCTG
                      ____________________________________________________________
consensus AAGAAGACAACGCAATGATTTTCCTTCAATAAGCAACTGGAAGGCGTCATTTATTTGCTG
 
. : . : . : . : . : . :
JMFN011I02+ AAATTCCATTTCGTGGGTGATGAATTCATCCAGCTTAACCACCCCTTGCATGCATTGTTT
rJMFF008D06- AAATTCCATTTCGTGGGTGATGAATTCATCCAGCTTAACCACCCCTTGCATGCATTGTTT
                      ____________________________________________________________
consensus AAATTCCATTTCGTGGGTGATGAATTCATCCAGCTTAACCACCCCTTGCATGCATTGTTT
 
. : . : . : . : . : . :
JMFN011I02+ GGCAAAGTGAGGCAGTTGTGACTTCCCTTTGAAGTCGCCGAAGACCGACGCCACCACCCT
rJMFF008D06- GGCAAAGTGAGGCAGTTGTGACTTCCCTTTGAAGTCGCCGAAGACCGACGCCACCACCCT
                      ____________________________________________________________
consensus GGCAAAGTGAGGCAGTTGTGACTTCCCTTTGAAGTCGCCGAAGACCGACGCCACCACCCT
 
. : . : . : . : . : . :
JMFN011I02+ CCGCCCGTCAAACAGCTCCATCGGGTGGAGAGGTAGCATCCTTGGGCTCGTATGGATCCC
rJMFF008D06- CCGCCCGTCAAACAGCTCCATCGGGTGGAGAGGTAGCATCCTTGGGCTCGTATGGATCCC
                      ____________________________________________________________
consensus CCGCCCGTCAAACAGCTCCATCGGGTGGAGAGGTAGCATCCTTGGGCTCGTATGGATCCC
 
. : . : . : . : . : . :
JMFN011I02+ TAGAATCACCGTCAGTCCCCAACCGTCACTGGTGGATAAAAATGCATCGCGGAGGACATC
rJMFF008D06- TAGAATCACCGTCAGTCCCCAACCGTCACTGGTGGATAAAAATGCATCGCGGAGGACATC
                      ____________________________________________________________
consensus TAGAATCACCGTCAGTCCCCAACCGTCACTGGTGGATAAAAATGCATCGCGGAGGACATC
 
. : . : . : . : . : . :
JMFN011I02+ GGGATCTCCGACACACTCAAAGCTATAGTGCACACCACCTCCAGTCATTTCGTGAATTGT
rJMFF008D06- GGGATCTCCGACACACTCAAAGCTATAGTGCACACCACCTCCAGTCATTTCGTGAATTGT
                      ____________________________________________________________
consensus GGGATCTCCGACACACTCAAAGCTATAGTGCACACCACCTCCAGTCATTTCGTGAATTGT
 
. : . : . : . : . : . :
JMFN011I02+ CTCGTGAACTGGCTTGTCAAGTTCCTTTGGGTTTATGAAATGGGTAATTCCAACAGCTTC
rJMFF008D06- CTCGTGAACTGGCTTGTCAAGTTCCTTTGGGTTTATGAAATGGGTAATTCCAACAGCTTC
                      ____________________________________________________________
consensus CTCGTGAACTGGCTTGTCAAGTTCCTTTGGGTTTATGAAATGGGTAATTCCAACAGCTTC
 
. : . : . : . : . : . :
JMFN011I02+ ACCTTTGATACGTTTCTTAGAATTGGTGTCGATTCCAATAATTTTTGACGCACCTCTAGT
rJMFF008D06- ACCTTTGATACGTTTCTTAGAATTGGTGTCGATTCCAATAATTTTTGACGCACCTCTAGT
JMFS108F10+ TCCAATAATTTTTGACGCACCTCTAGT
                      ____________________________________________________________
consensus ACCTTTGATACGTTTCTTAGAATTGGTGTCGATTCCAATAATTTTTGACGCACCTCTAGT
 
. : . : . : . : . : . :
JMFN011I02+ TCGTGCACCTTC
rJMFF008D06- TCGTGCACCTTCCACAACAGCCAAACCAACACCTCCGAGGCCAAAAACAGCAATTGTCTC
JMFS108F10+ TCGTGCACCTTCCACAACAGCCAAACCAACACCTCCGAGGCCAAAAACAGCAATTGTCTC
                      ____________________________________________________________
consensus TCGTGCACCTTCCACAACAGCCAAACCAACACCTCCGAGGCCAAAAACAGCAATTGTCTC
 
. : . : . : . : . : . :
rJMFF008D06- TCCCGCTTGAACGTCGGCGGTGTTCCACACGGCTCCAAGTCCGGTAGAAACTCCACAGCT
JMFS108F10+ TCCCGCTTGAACGTCGGCGGTGTTCCACACGGCTCCAAGTCCGGTAGAAACTCCACAGCT
                      ____________________________________________________________
consensus TCCCGCTTGAACGTCGGCGGTGTTCCACACGGCTCCAAGTCCGGTAGAAACTCCACAGCT
 
. : . : . : . : . : . :
rJMFF008D06- AAG
JMFS108F10+ AAGCAGGGTCATGGTTTTGAGGGGAGCCATTGGGTCCAGCTTGAGTACACAGGCGGAATC
                      ____________________________________________________________
consensus AAGCAGGGTCATGGTTTTGAGGGGAGCCATTGGGTCCAGCTTGAGTACACAGGCGGAATC
 
. : . : . : . : . : . :
JMFS108F10+ AAGAACAGTGTACTGTGTAAATGTAGAAGTGTTGAGGAAATGATAGATGGGGTTCCCATC
                      ____________________________________________________________
consensus AAGAACAGTGTACTGTGTAAATGTAGAAGTGTTGAGGAAATGATAGATGGGGTTCCCATC
 
. : . : . : . : . : . :
JMFS108F10+ TTTGCTGGAAAACCGACACTTGCCGTCATTAATCATCGTACTCTTGAAAGGACTGACCCG
                      ____________________________________________________________
consensus TTTGCTGGAAAACCGACACTTGCCGTCATTAATCATCGTACTCTTGAAAGGACTGACCCG
 
. : . : . : . : . : . :
JMFS108F10+ AAAATCTTTGCACAGATTGGTCTTGTCGGATTTGCAGTAGGCGCAGTCGCCGCATTCCCC
                      ____________________________________________________________
consensus AAAATCTTTGCACAGATTGGTCTTGTCGGATTTGCAGTAGGCGCAGTCGCCGCATTCCCC
 
. : . : . : . : . : . :
JMFS108F10+ GTTGAAGATTGGTACGACGTGGTCTCCCGGTTTCAAGTCCCCCACCCCTTCTCCCACGCT
                      ____________________________________________________________
consensus GTTGAAGATTGGTACGACGTGGTCTCCCGGTTTCAAGTCCCCCACCCCTTCTCCCACGCT
 
. : . : . : . : . : . :
JMFS108F10+ TTCAACCACCCCAGAGGCTTCGTGTCCGAGAATTCGAGGGAAAACACGTTGGGCTTCGTT
                      ____________________________________________________________
consensus TTCAACCACCCCAGAGGCTTCGTGTCCGAGAATTCGAGGGAAAACACGTTGGGCTTCGTT
 
. : . : . : . : . : . :
JMFS108F10+ CTTGCCTAGCCAGGCACTTAGGTCGGTATGGCAAATCGAAGTGAAAAGAATCTTGACTCT
                      ____________________________________________________________
consensus CTTGCCTAGCCAGGCACTTAGGTCGGTATGGCAAATCGAAGTGAAAAGAATCTTGACTCT
 
. : . : . : . : . : . :
JMFS108F10+ GACTTCCATTTTCTGCGGCGGAGCCACCAGAATGTCCTCCACGATCAAGGGCTGTCCGGG
                      ____________________________________________________________
consensus GACTTCCATTTTCTGCGGCGGAGCCACCAGAATGTCCTCCACGATCAAGGGCTGTCCGGG