Previous Contig 003743:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039J11Sequence594003743 (5)gb:AF130423_1770804e-110Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L681008199 (7)gb:AF130423_17708049e-20Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMFF045M01Sequence605003743 (5)gb:AY508971_1610257e-116Pisum sativum cultivar Torsdag mutant cryptochrome 1-1 protein (cry1-1) mRNA, co587008199 (7)gb:AY508971_16102574e-08Pisum sativum cultivar Torsdag mutant cryptochrome 1-1 protein (cry1-1) mRNA, co
JMFS106E02Sequence343003743 (5)gb:AF130423_17708043e-45Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMFS137G08Sequence195003743 (5)gb:AY351861_16017413e-27Orobanche minor cryptochrome 1 mRNA, complete cds.
JMSF031N11Sequence640003743 (5)gb:AY508971_1610257e-115Pisum sativum cultivar Torsdag mutant cryptochrome 1-1 protein (cry1-1) mRNA, co767023494gb:AF130423_17708043e-31Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031N11+ TTN
                      ____________________________________________________________
consensus TTN
 
. : . : . : . : . : . :
JMSF031N11+ TTCCATACCGTTNTCAATTGCAGCTCTCGAGGCGGCTTCACGCTGTGCCATATGAACAAG
                      ____________________________________________________________
consensus TTCCATACCGTTNTCAATTGCAGCTCTCGAGGCGGCTTCACGCTGTGCCATATGAACAAG
 
. : . : . : . : . : . :
JMSF031N11+ GGCTGCTTGCAATCTTACCTTTGNTGCATCGATTTCAACAACCGGAAGAGGATAGTTGGA
JMFF045M01+ AGAGGATAGTTGGA
                      ____________________________________________________________
consensus GGCTGCTTGCAATCTTACCTTTGNTGCATCGATTTCAACAACCGGAAGAGGATAGTTGGA
 
. : . : . : . : . : . :
JMSF031N11+ ACCTAGTTCAATTCCAGCTGCTTGGAGAACCGACTCGGGTGCATTCCAAGGATGGTGTAT
JMFF045M01+ TCCTAGCTCAATCCCAGCTGCTTGCAGAACAGATTCCGGGGCGTTCCAGGGATGGTGAAT
                      ____________________________________________________________
consensus TCCTAGTTCAATTCCAGCTGCTTGGAGAACCGATTCGGGTGCGTTCCAGGGATGGTGTAT
 
. : . : . : . : . : . :
JMSF031N11+ CCATTCGGTAGGAAGTCGAGCAAGCTCGGGAAGCCAACGGCGTACATACTCCCCATTCGG
JMFF045M01+ CCACTCGGTTGGAAGCCGAACAAGTTCAGGAAGCCACCGACGTACATACTCCCCATTCGG
                      ____________________________________________________________
consensus CCATTCGGTTGGAAGTCGAGCAAGTTCGGGAAGCCACCGGCGTACATACTCCCCATTCGG
 
. : . : . : . : . : . :
JMSF031N11+ GTCAAATTTGTAGCCCTCAAACTGTGGATTATCAATTCGATCAAATTCACGGGCATCTGG
JMFF045M01+ GTCACATTTGTAACCTTCAAACTGTGGATTATCAATGCGGTCTAATTCGCGGCCATCGGG
JMFF039J11+ AATTCGCGGCCATCGGG
                      ____________________________________________________________
consensus GTCACATTTGTAGCCTTCAAACTGTGGATTATCAATTCGGTCTAATTCGCGGCCATCGGG
 
. : . : . : . : . : . :
JMSF031N11+ TAGGGTACCAGTGATGTATTGCCAACCAAGAGCATCGCTCTCGAGATCTGCATCTAACAG
JMFF045M01+ TATGGTGCCAGAGATGTATTGCCAACCGAGAGCATCACTCTCGAGATCTGCATCTAATAG
JMFF039J11+ TATGGTGCCAGAGATGTATTGCCAACCGAGAGCATCACTCTCGAGATCTGCATCTAATAG
                      ____________________________________________________________
consensus TATGGTGCCAGAGATGTATTGCCAACCGAGAGCATCACTCTCGAGATCTGCATCTAATAG
 
. : . : . : . : . : . :
JMSF031N11+ AGTATCCCAAAAGTACTTCATTCCCCATCTCCAAGAAAGCTGAAGAACCTTAACGAAGAA
JMFF045M01+ AGTATCCCAAAAGTACTTCACTCCCCATCTCCATGGAAGCTGCAAAACTTTGACAAAGAA
JMFF039J11+ AGTATCCCAAAAGTACTTCACTCCCCATCTCCATGGAAGCTGCAAAACTTTGACAAAGAA
                      ____________________________________________________________
consensus AGTATCCCAAAAGTACTTCACTCCCCATCTCCATGGAAGCTGCAAAACTTTGACAAAGAA
 
. : . : . : . : . : . :
JMSF031N11+ ACTCGACACTACAACTCGTATCCGGTCATGTAACCATCCAGTAGCCCAGAGTTCTCTCAT
JMFF045M01+ ACTAGAAACTACAACGCGTATCCTATCATGTAGCCAGCCGGTTGCCCAGAGCTCTCTCAT
JMFF039J11+ ACTAGAAACTACAACGCGTATCCTATCATGTAGCCAGCCGGTTGCCCAGAGCTCTCTCAT
                      ____________________________________________________________
consensus ACTAGAAACTACAACGCGTATCCTATCATGTAGCCAGCCGGTTGCCCAGAGCTCTCTCAT
 
. : . : . : . : . : . :
JMSF031N11+ GCCCGCATCCACCAAAGGATAACCCGTTCTGCCTTGCCTCCACGCCTTAAAATAGCCCTC
JMFF045M01+ ACCAGCATCCACGAGAGGGTAACCAGTTCTGCCTTGCCTCCACGCCTTAAAGTAGCCCTC
JMFF039J11+ ACCAGCATCCACGAGAGGGTAACCAGTTCTGCCTTGCCTCCACGCCTTAAAGTAGCCCTC
                      ____________________________________________________________
consensus ACCAGCATCCACGAGAGGGTAACCAGTTCTGCCTTGCCTCCACGCCTTAAAGTAGCCCTC
 
. : . : . : . : . : . :
JMSF031N11+ ATCTACTACCCAAGGAAAGTGCTTTAGATGACCAAGAAGGGGCCTTTCATGGCTGTAAGG
JMFF045M01+ GTTAATTACCCATGGGAAGTACTTTAGATGACCAAGGAGAGGCCTTTCGTGGCTGTATGG
JMFS137G08+ GTACTTTAGATGACCAAGCAGAGGCCTTTCGTGGCTGTATGA
JMFF039J11+ GTTAATTACCCATGGGAAGTACTTTAGATGACCAAGGAGAGGCCTTTCGTGGCTGTATGG
JMFS106E02+ GTACTTTAGATGACCAAGGAGAGGCCTTTCGTGGGTGTATGG
                      ____________________________________________________________
consensus GTTAATTACCCATGGGAAGTACTTTAGATGACCAAGGAGAGGCCTTTCGTGGCTGTATGG
 
. : . : . : . : . : . :
JMSF031N11+ ATGATTGAAACTCATATATCTTGAATACTCTC
JMFF045M01+ ATGGTTAAAGCTCATATATCTCGAATACTCTCTCAGCCCAATGGATTTGAGGAACAGATT
JMFS137G08+ ATGGTTAAAGCTCATATATCTCGAATACTCTCTCAGCCCAATGGATTTGAGGAACAGATT
JMFF039J11+ ATGGTTAAAGCTCATATATCTCGAATACTCTCTCAGCCCAATGGATTTGAGGAACAGATT
JMFS106E02+ ATGGTTAAAGCTCATATATCTCGAACACTCTCTCAGCCCAATGGATTTGAGGAACAGATT
                      ____________________________________________________________
consensus ATGGTTAAAGCTCATATATCTCGAATACTCTCTCAGCCCAATGGATTTGAGGAACAGATT
 
. : . : . : . : . : . :
JMFF045M01+ CACACTCTCTTCGC
JMFS137G08+ CACACTCTATTCGCCTGCTATGTTCCCTTCGTTGGCCCAGAGAACTTGCTTCATTCGAAC
JMFF039J11+ CACACTCTCTTCGCCTGCTATGTTCCCTTCGTTGGCCCAGAGAACTTGCTTCATTCGAAC
JMFS106E02+ CACACTCTCTTCGCGTGATATGTTCCCTTCGTGGGCACAGAGAACGTGTTTCATTCGAAC
                      ____________________________________________________________
consensus CACACTCTCTTCGCCTGCTATGTTCCCTTCGTTGGCCCAGAGAACTTGCTTCATTCGAAC
 
. : . : . : . : . : . :
JMFS137G08+ CAGATGGAATGCTTTCCGAACGCTTACTTCCCC
JMFF039J11+ CAGATGGAATGCTTTCCGAACGCTTACTTCCCCAAAGTGTAAATGCGGGGAAAGAAATGA
JMFS106E02+ CAGATGGAATGCTTTCCGAACGCTTACTTCCCCAAAGTGTAAATGCGGGGAAAAAAATGA
                      ____________________________________________________________
consensus CAGATGGAATGCTTTCCGAACGCTTACTTCCCCAAAGTGTAAATGCGGGGAAAGAAATGA
 
. : . : . : . : . : . :
JMFF039J11+ GGTTGTTGCACTATCAGCCTTTCTTCGGTTCTGTGAGTACTCAATCAATGGCCCGTTTAT
JMFS106E02+ GGGTGTTGCACTAACAGCCTTTCTGGGGTTGTGTGAGTACTCAATCAATGGCCCGTATAT
                      ____________________________________________________________
consensus GGTTGTTGCACTATCAGCCTTTCTTGGGTTGTGTGAGTACTCAATCAATGGCCCGTTTAT
 
. : . : . : . : . : . :
JMFF039J11+ AAAAGCTGTTAATGCCTTAT
JMFS106E02+ AAAAGCTGTAAATGCCTTATGAGCATTCCTCCAAACAGGGGACCATGCCCGAGCAAAAAG
                      ____________________________________________________________
consensus AAAAGCTGTTAATGCCTTATGAGCATTCCTCCAAACAGGGGACCATGCCCGAGCAAAAAG