Previous Contig 003741:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C04Sequence656003741 (95)gb:AF508793_18070158e-47Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF003F13Sequence706003741 (95)gb:AF508793_18070151e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF004P21Sequence544003741 (95)701003741 (95)gb:AF508793_18070152e-50Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF004P23Sequence577003741 (95)673003741 (95)gb:AF508793_18070151e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF005H14Sequence512003741 (95)728003741 (95)gb:AF508793_18070153e-52Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF006E19Sequence495003741 (95)699003741 (95)gb:AF508793_18070153e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF012H15Sequence532003741 (95)681003741 (95)gb:AF508793_18070155e-45Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF013N16Sequence609003741 (95)714003741 (95)gb:AF508793_18070154e-53Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF016M14Sequence579003741 (95)754003741 (95)gb:AF508793_18070156e-63Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF019B02Sequence576003741 (95)714003741 (95)gb:AF508793_18070154e-53Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF020F20Sequence508003741 (95)694003741 (95)gb:AF508793_18070151e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF020O20Sequence563003741 (95)736009187 (3)gb:AP004667_18429663e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P043
JMFF022E16Sequence512003741 (95)652003741 (95)gb:AF508793_18070153e-45Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF022K08Sequence512003741 (95)742003741 (95)gb:AB010071_15108932e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY063788_1565
JMFF024H07Sequence493003741 (95)698003741 (95)gb:AF508793_18070152e-50Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF024P18Sequence535003741 (95)770003741 (95)gb:AF508793_18070152e-58Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF025K23Sequence350003741 (95)537003741 (95)gb:AF508793_18070152e-24Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF027B10Sequence246003741 (95)757003741 (95)gb:AF508793_18070152e-61Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF027M04Sequence511003741 (95)713003741 (95)gb:AF508793_18070154e-45Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF028H23Sequence546003741 (95)663003741 (95)gb:AF508793_18070154e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF034E01Sequence579003741 (95)
JMFF035G14Sequence578003741 (95)618003741 (95)gb:AF508793_18070154e-41Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF035O03Sequence556003741 (95)712009187 (3)gb:AP004667_18429663e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P043
JMFF037N12Sequence581003741 (95)708003741 (95)gb:AF508793_18070152e-50Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF041I23Sequence639003741 (95)560003741 (95)gb:AF508793_18070157e-43Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF045A16Sequence641003741 (95)631003741 (95)gb:AF508793_18070155e-35Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFF046A24Sequence397003741 (95)gb:AY093138_15750929e-63Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658549003741 (95)gb:AF508793_18070153e-17Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFN002C04Sequence530003741 (95)gb:AY093138_15750924e-54Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFN007M01Sequence561003741 (95)gb:AF508793_18070153e-28Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFN010M24Sequence625003741 (95)gb:AF508793_18070151e-35Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFN013K01Sequence532003741 (95)
JMFN019H02Sequence599003741 (95)gb:AF508793_18070153e-32Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFN028H01Sequence535003741 (95)
JMFS002D10Sequence486003741 (95)gb:AY093138_15750925e-12Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS017G04Sequence605003741 (95)
JMFS022B09Sequence614003741 (95)gb:AY093138_15750922e-60Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS022G07Sequence633003741 (95)
JMFS027E04Sequence622003741 (95)gb:AY093138_15750928e-99Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS042F02Sequence616003741 (95)
JMFS045B11Sequence610003741 (95)gb:AY093138_15750921e-91Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS060F09Sequence627003741 (95)gb:AY093138_15750927e-71Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS074F08Sequence638003741 (95)gb:AF508793_18070155e-07Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFS076C06Sequence627003741 (95)gb:AF508793_18070150.032Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFS082F07Sequence627003741 (95)
JMFS082F09Sequence315003741 (95)
JMFS085B10Sequence627003741 (95)
JMFS096H06Sequence616003741 (95)
JMFS106C07Sequence615003741 (95)
JMFS110D09Sequence625003741 (95)gb:AF508793_18070152e-04Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFS111A03Sequence622003741 (95)
JMFS114A12Sequence552003741 (95)gb:AF508793_18070155e-22Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFS116A03Sequence567003741 (95)
JMFS128C02Sequence405003741 (95)
JMFS132E01Sequence621003741 (95)
JMFS132E02Sequence450003741 (95)
JMFS134B08Sequence626003741 (95)gb:AY093138_15750928e-96Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS139F09Sequence612003741 (95)gb:AY093138_15750921e-88Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS147F09Sequence641003741 (95)gb:AF508793_18070150.002Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMFS148G01Sequence626003741 (95)
JMFS155D08Sequence593003741 (95)gb:AY093138_15750924e-87Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMFS162G08Sequence424003741 (95)
JMSF019F08Sequence316003741 (95)741003741 (95)gb:AF508793_18070152e-62Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMSF030G18Sequence615003741 (95)696003741 (95)gb:AF508793_18070154e-49Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMSF031L03Sequence644003741 (95)733003741 (95)gb:AF508793_18070154e-61Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMSF035K20Sequence620003741 (95)652003741 (95)gb:AF508793_18070154e-43Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.
JMSF038I18Sequence615003741 (95)870003741 (95)gb:AY093138_15750921e-81Arabidopsis thaliana putative protein (At4g26850) mRNA, complete cds.>gb:BT00658
JMSF047M03Sequence580003741 (95)736003741 (95)gb:AF508793_18070154e-61Arabidopsis thaliana VTC2 (VTC2) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046A24- ACCCT
                      ____________________________________________________________
consensus ACCCT
 
. : . : . : . : . : . :
rJMFF046A24- GGAGAGTTTTTTTTTTTTTTTTTGACACATAAAAACAATCCAATGTTTTAACATACTTGA
rJMFF027M04- ATGTTTTAACATACTTGA
rJMFF037N12- ACATACTTGA
rJMFF006E19- CATACTTGA
rJMFF020F20- TGA
rJMFF004P21- CATACTTGA
rJMSF030G18- ACATACTTGA
rJMFF012H15- CTTGA
rJMFF003F13- ACATACTTGA
rJMFF024H07- ACTTGA
JMFN010M24+ TGTTTTAACATACTTGA
rJMFF045A16- AACATACTTGA
JMFN019H02+ TGTTTTAACATACTTGA
JMFS128C02- AACATACTTGA
JMFS162G08- AACATACTTGA
JMFN007M01+ GTTTTAACATACTTGA
rJMFF005H14- ATGTTTTAACATACTTGA
rJMFF019B02- TTGA
                      ____________________________________________________________
consensus GGAGAGTTTTTTTTTTTTTTTTTGACACATAAAAACAATCCAATGTTTTAACATACTTGA
 
. : . : . : . : . : . :
rJMFF046A24- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF027M04- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF037N12- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF006E19- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF020F20- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF004P21- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMSF030G18- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF004P23- AGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF028H23- GATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF003C04- CCATTANATTTCAAGATACTACAAGCCGTTTTACAAGATTCANAAACCA
rJMFF022E16- AGATACTACAAG-CGTTTTACAAGACTCAGAAACCA
rJMFF012H15- AACATTGCAATCCATTANATTTCAAGATACTACAAG-CGTTTTACAAGATTCANAAACCA
rJMFF035G14- GCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF003F13- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF024H07- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFN010M24+ AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF045A16- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF025K23- AAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFN019H02+ AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFS128C02- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFS162G08- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFN007M01+ AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
JMFS114A12+ ACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF005H14- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF019B02- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF024P18- CCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF022K08- AGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMSF047M03- AG-CGTTTT-CAAGATTCAGAAACCA
rJMSF031L03- AG-CGTTTT--CAGATTCAGAAACCA
rJMSF035K20- AG-CGTTTT-CAAGATTCAGAAACCA
rJMSF019F08- AG-CGTTTT-CAAGATTCAGAAACCA
rJMFF016M14- AGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF027B10- TTACATTTC-AGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMFF013N16- AGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
rJMSF038I18- AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
                      ____________________________________________________________
consensus AACATTGCAATCCATTACATTTCAAGATACTACAAG-CGTTTTACAAGATTCAGAAACCA
 
. : . : . : . : . : . :
rJMFF046A24- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF027M04- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF037N12- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF006E19- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF020F20- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF004P21- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMSF030G18- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF004P23- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF028H23- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF041I23- ACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF003C04- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF022E16- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF012H15- CACACCATATCTTACAACATAANAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF035G14- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF003F13- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF024H07- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFN010M24+ CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF045A16- CACACCATATCTCACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF025K23- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFN019H02+ CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFS128C02- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFS162G08- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFN007M01+ CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
JMFS114A12+ CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF005H14- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF019B02- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF024P18- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF022K08- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMSF047M03- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMSF031L03- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMSF035K20- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGNTTGCCGCCTT
rJMSF019F08- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF016M14- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF027B10- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMFF013N16- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
rJMSF038I18- CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
                      ____________________________________________________________
consensus CACACCATATCTTACAACATAAGAATAATAATCCTGGGAATGATGATGGCTTGCCGCCTT
 
. : . : . : . : . : . :
rJMFF046A24- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF027M04- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF037N12- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF006E19- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF020F20- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF004P21- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF030G18- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF004P23- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF028H23- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF041I23- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF003C04- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF022E16- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF012H15- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTANCACATAATANAAAGATACCC
rJMFF035G14- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF003F13- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF024H07- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFN010M24+ ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF045A16- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF025K23- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFN019H02+ ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFS128C02- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFS162G08- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFN007M01+ ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
JMFS114A12+ ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF005H14- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF019B02- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF024P18- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF022K08- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF047M03- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF031L03- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF035K20- ATTCACAAATATTCCANATGGTANCTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF019F08- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF016M14- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF027B10- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMFF013N16- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
rJMSF038I18- ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
                      ____________________________________________________________
consensus ATTCACAAATATTCCACATGGTAACTGGGGAAGCCATTAACACATAATAGAAAGATACCC
 
. : . : . : . : . : . :
rJMFF046A24- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF027M04- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF037N12- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF006E19- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF020F20- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF004P21- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMSF030G18- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF004P23- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF028H23- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF041I23- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF003C04- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF022E16- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF012H15- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF035G14- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF003F13- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF024H07- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFN010M24+ ATCACATAACATAACAGGGAGACAGATATCCATTTGCGGCTACACAGGAACCATGGCGGG
rJMFF045A16- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF025K23- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFN019H02+ ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFS128C02- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFS162G08- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFN007M01+ ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
JMFS114A12+ ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF005H14- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF019B02- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF024P18- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF022K08- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMSF047M03- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMSF031L03- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMSF035K20- ATCACATAACATAANAGGGAGACAGATATCCGNTTGCGGCTACACAGGAACNATGGCGGG
rJMSF019F08- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF016M14- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF027B10- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMFF013N16- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
rJMSF038I18- ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
                      ____________________________________________________________
consensus ATCACATAACATAACAGGGAGACAGATATCCGTTTGCGGCTACACAGGAACCATGGCGGG
 
. : . : . : . : . : . :
rJMFF046A24- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF027M04- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF037N12- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF006E19- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF020F20- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF004P21- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMSF030G18- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF004P23- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF028H23- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF041I23- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF003C04- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF022E16- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF012H15- GNGGGAGCCTTTGAGCGAATCCATCTCTTCNTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF035G14- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF003F13- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF024H07- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFN010M24+ GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF045A16- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF025K23- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFN019H02+ GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFS128C02- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFS162G08- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFN007M01+ GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
JMFS114A12+ GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF005H14- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF019B02- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF024P18- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF022K08- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMSF047M03- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMSF031L03- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMSF035K20- GTGGGAGCCTTTGANCGAATCCATCTCTTCGTCCATTGGNTGAGGAGGAGGTTCAACGNC
rJMSF019F08- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF016M14- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF027B10- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMFF013N16- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
rJMSF038I18- GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
                      ____________________________________________________________
consensus GTGGGAGCCTTTGAGCGAATCCATCTCTTCGTCCATTGGCTGAGGAGGAGGTTCAACGTC
 
. : . : . : . : . : . :
rJMFF046A24- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF027M04- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF037N12- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF006E19- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF020F20- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF004P21- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF030G18- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF004P23- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF028H23- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF041I23- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF003C04- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF022E16- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF012H15- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCANAGAT
rJMFF035G14- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF003F13- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF024H07- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFN010M24+ TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF045A16- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF025K23- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFN019H02+ TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFS128C02- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFS162G08- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFN007M01+ TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
JMFS114A12+ TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF005H14- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF019B02- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF024P18- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF022K08- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF047M03- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF031L03- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF035K20- TGGCTTCTCGCCNCGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF019F08- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF016M14- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF027B10- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMFF013N16- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
rJMSF038I18- TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
                      ____________________________________________________________
consensus TGGCTTCTCGCCACGCACCTCATGCGATGCCTCGGTGTTGCACCCGATGGCTTCAAAGAT
 
. : . : . : . : . : . :
rJMFF046A24- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF027M04- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF037N12- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF006E19- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF020F20- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF004P21- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF030G18- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF004P23- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF028H23- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF041I23- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF003C04- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF022E16- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF012H15- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGNCAGGAGCCTCCA
rJMFF035G14- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF003F13- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF024H07- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
JMFN010M24+ GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF045A16- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF025K23- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
JMFN019H02+ GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
JMFS128C02- GAGGGCAGTCACTTCTTGGAACCTCTCCT
JMFS162G08- GAGGGCAGTCACTT
JMFN007M01+ GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
JMFS114A12+ GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF005H14- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF019B02- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF024P18- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF022K08- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF047M03- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF031L03- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF035K20- GAGGGCAGTCNCTTCTTGGAACCTCTCCTCCNAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF019F08- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF016M14- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF027B10- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMFF013N16- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
rJMSF038I18- GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
                      ____________________________________________________________
consensus GAGGGCAGTCACTTCTTGGAACCTCTCCTCCGAGAGCGAGACCTCGGCCAGGAGCCTCCA
 
. : . : . : . : . : . :
rJMFF046A24- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF027M04- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF037N12- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF006E19- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF020F20- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF004P21- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMSF030G18- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF004P23- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF028H23- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF041I23- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF003C04- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF022E16- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF012H15- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF035G14- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF003F13- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF024H07- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
JMFN010M24+ AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF045A16- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF025K23- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCGCC
JMFN019H02+ AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
JMFN007M01+ AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
JMFS114A12+ AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF005H14- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF019B02- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF024P18- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF022K08- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMSF047M03- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMSF031L03- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMSF035K20- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACNATGTGGCCG-C
rJMSF019F08- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF016M14- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF027B10- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMFF013N16- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
rJMSF038I18- AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
                      ____________________________________________________________
consensus AGCGTTTGCCTCTGATGCCCCCTCGTAATCCTCCTTCCTCTTCAGCACAATGTGGCCG-C
 
. : . : . : . : . : . :
rJMFF046A24- TGATTT
rJMFF027M04- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF037N12- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF006E19- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCAACTCTCCA
rJMFF020F20- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF004P21- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF030G18- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF004P23- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF028H23- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF041I23- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF003C04- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF022E16- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF012H15- TGATTTCCCANACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF035G14- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF003F13- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF024H07- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
JMFN010M24+ TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF045A16- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF025K23- TGATTTCCCAGANAGCGGGGTTCACTTGG-GTGTNCAGGAGCTCGCTACTCACCTCTCCA
JMFN019H02+ TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
JMFN007M01+ TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
JMFS114A12+ TGATTTCCCAGACAGCGGGGTTCTCTTGGAGAGGTGAGTAGCGAGCTCCTGGACAC-CCA
rJMFF005H14- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF019B02- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF024P18- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF022K08- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF047M03- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF031L03- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF035K20- TGATTTCCNAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF019F08- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF016M14- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF027B10- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMFF013N16- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
rJMSF038I18- TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
JMFS134B08+ CTCGCTACTCACCTCTCCA
                      ____________________________________________________________
consensus TGATTTCCCAGACAGCGGGGTTCACTTGG-GTGTCCAGGAGCTCGCTACTCACCTCTCCA
 
. : . : . : . : . : . :
rJMFF027M04- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF037N12- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF006E19- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF020F20- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF004P21- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF030G18- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF004P23- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF028H23- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF041I23- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF003C04- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF022E16- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF012H15- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCNGAN
rJMFF035G14- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF003F13- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF024H07- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
JMFN010M24+ AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAG
rJMFF045A16- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTC
rJMFF025K23- AGAGCTTGCTTCTCCGCATAGC
JMFN019H02+ AGAGCTTGCTTCTCCGCATAGCACTG
JMFN007M01+ AGAGCTTG
JMFS114A12+ AGTGAACCCCGCTG
rJMFF005H14- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF019B02- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF024P18- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF022K08- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF047M03- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF031L03- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF035K20- AGAGNTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF019F08- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF016M14- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMFF027B10- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAAGAAAACTCTTTTTCCGAGATCGGAG
rJMFF013N16- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
rJMSF038I18- AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
JMFS134B08+ AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
JMFS155D08+ GAGGAAGGAGGAAAACTC-TTTTCCGAGATCGGAG
                      ____________________________________________________________
consensus AGAGCTTGCTTCTCCGCATAGCACTGAGGAAGGAGGAAAACTCTTTTTCCGAGATCGGAG
 
. : . : . : . : . : . :
rJMFF027M04- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTTGGGAGACAA
rJMFF037N12- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF006E19- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF020F20- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF004P21- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMSF030G18- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF004P23- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF028H23- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF041I23- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAG
rJMFF003C04- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF022E16- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACAGGGAGTT-GGAGACAA
rJMFF012H15- ATGANGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF035G14- ATGAGGACATTATAAGGAATGTTG
rJMFF003F13- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF024H07- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF005H14- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF019B02- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF024P18- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF022K08- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMSF047M03- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMSF031L03- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMSF035K20- ATGANGACATTATAAGGAATGTTGTTTTCTTGGAGGCNAATACA-GGAGTT-GGAGACAA
rJMSF019F08- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF016M14- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF027B10- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMFF013N16- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
rJMSF038I18- ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
JMFS134B08+ ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
JMFS155D08+ ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
                      ____________________________________________________________
consensus ATGAGGACATTATAAGGAATGTTGTTTTCTTGGAGGCAAATACA-GGAGTT-GGAGACAA
 
. : . : . : . : . : . :
rJMFF027M04- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAG
rJMFF037N12- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAA
rJMFF006E19- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCA
rJMFF020F20- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAA
rJMFF004P21- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAA
rJMSF030G18- CATTGGCCAAATCCTCCAGGGTATTCCCGCC
rJMFF004P23- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTC
rJMFF028H23- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTT
rJMFF003C04- CATTGGCCAAA
rJMFF022E16- CATTGGCCAAATCCTCCAGG
rJMFF012H15- CATTGGCCAAATCCTCCAGGG
rJMFF003F13- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTC
rJMFF024H07- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAA
rJMFF005H14- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGG
rJMFF019B02- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGG
rJMFF024P18- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMFF022K08- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMSF047M03- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMSF031L03- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMSF035K20- CATTGGNCAAATCCTCGAGGNTATTCCCG
rJMSF019F08- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMFF016M14- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMFF027B10- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
rJMFF013N16- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGA
rJMSF038I18- CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
JMFS134B08+ CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
JMFS155D08+ CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
                      ____________________________________________________________
consensus CATTGGCCAAATCCTCCAGGGTATTCCCGCCTTCAAAGAGGAGACCCCTGACGGGATAAT
 
. : . : . : . : . : . :
rJMFF024P18- TCAGAATCTCGGAAAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
rJMFF022K08- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTNCTAG
rJMSF047M03- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTC
rJMSF031L03- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTC
rJMSF019F08- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGC
rJMFF016M14- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
rJMFF027B10- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGG
rJMSF038I18- TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
JMFS134B08+ TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
JMFS155D08+ TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
JMFS027E04+ TTCCTAGTCGGGGCC
                      ____________________________________________________________
consensus TCAGAATCTCGG-AAATCTTCACGCCACTATCAGCAGTAGTTATCTTCCTAGTCGGGGCC
 
. : . : . : . : . : . :
rJMFF024P18- TTCTCA
rJMFF016M14- TTCT
rJMSF038I18- TTCTCAATCGGGAAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
JMFS134B08+ TTCTCAATCGGGAAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
JMFS155D08+ TTCTCAATCGGGAAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
JMFS027E04+ TTCTCAATCGGGAAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
JMFS045B11+ AAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
                      ____________________________________________________________
consensus TTCTCAATCGGGAAGGGTACAGCCAAGTAGTAAGCCTGGAAGTGAAGGTGGTTGATGGTG
 
. : . : . : . : . : . :
rJMSF038I18- GCAAATGCACCCAAGCTGTTATAGCCCAACCTGAAG
JMFS134B08+ GCAAATGCACCCAAGCTGTTATAGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
JMFS155D08+ GCAAATGCACCCAAGCTGTTATAGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
JMFS027E04+ GCAAATGCACCCAAGCTGTTATAGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
JMFS045B11+ GCANATGCACCCAAGCTGTTATAGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
JMFS139F09+ AGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
                      ____________________________________________________________
consensus GCAAATGCACCCAAGCTGTTATAGCCCAACCTGAAGTAGGGATTCGCAGCTTCTTCAGCC
 
. : . : . : . : . : . :
JMFS134B08+ ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
JMFS155D08+ ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
JMFS027E04+ ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
JMFS045B11+ ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
JMFS139F09+ ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
                      ____________________________________________________________
consensus ATGTGAAGTGCGAGCAGGAAGCTGTCTCTGTCGATCCGTTGGGGCAGGCATTCAAGAACC
 
. : . : . : . : . : . :
JMFS134B08+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFS155D08+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFF046A24+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFS027E04+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFS045B11+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFS139F09+ TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
JMFS060F09+ GACACTC
                      ____________________________________________________________
consensus TTAGGAATCAGCAGGACATGGCCATATTCAATAGGGCTAACATTAATAGCAACGACACTC
 
. : . : . : . : . : . :
JMFS134B08+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFS155D08+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFF046A24+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFS027E04+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFS045B11+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFS139F09+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
JMFS060F09+ GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
                      ____________________________________________________________
consensus GGAGAGCTCTCGGGGTCGATGGGCGCATCAGGGAAGAACTGGATCTCGCCATCATCACTC
 
. : . : . : . : . : . :
JMFS134B08+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFS155D08+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFF046A24+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFS027E04+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFS045B11+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFS139F09+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFS060F09+ GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
JMFN002C04+ TAGTGAAGTTGAACTTGCTGCCA
JMFS022B09+ TCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
                      ____________________________________________________________
consensus GCTTCAAACTGGAAGAGCAACTCTTCCTGCCCAACCTTAGTGAAGTTGAACTTGCTGCCA
 
. : . : . : . : . : . :
JMFS134B08+ TCAAAGGGCT
JMFS155D08+ TCAAAGGGCTGCAGCACCTT
JMFF046A24+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFS027E04+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFS045B11+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFS139F09+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFS060F09+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFN002C04+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
JMFS022B09+ TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
                      ____________________________________________________________
consensus TCAAAGGGCTGCAGCACCTTATCAACTCGAAACTCAGTCGGCCTTTTCTTGAGGTGCCTC
 
. : . : . : . : . : . :
JMFF046A24+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFS027E04+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFS045B11+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFS139F09+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFS060F09+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFN002C04+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
JMFS022B09+ CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
                      ____________________________________________________________
consensus CCCTCATTCAGCTGGGCTACGAAGCCATATTCCCCAGGAATCACCTTAGTTTCGCAAGCA
 
. : . : . : . : . : . :
JMFF046A24+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFS027E04+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFS045B11+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFS139F09+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFS060F09+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFN002C04+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
JMFS022B09+ GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
                      ____________________________________________________________
consensus GTGACATCATAACGAAAGAGCCCTCTCTGCATACGTTCCTCCCACTCCCCAAGAAGGAGG
 
. : . : . : . : . : . :
JMFF046A24+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATC
JMFS027E04+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCT
JMFS045B11+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
JMFS139F09+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
JMFS060F09+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
JMFN002C04+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
JMFS022B09+ GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
JMFS002D10+ CAGCCTTG
                      ____________________________________________________________
consensus GAGTCCAAGAAAGCAACCGGCGGCTCTTTGACATCCTCGGCTTCACCTGCGGCAGCCTTG
 
. : . : . : . : . : . :
JMFS045B11+ CAGTTGTTGAGCTTCTTGAAAG
JMFS139F09+ CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
JMFS060F09+ CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
JMFN002C04+ CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
JMFS022B09+ CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
JMFS002D10+ CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
JMFS074F08+ TGGAAGGCAGCAGTTG
                      ____________________________________________________________
consensus CAGTTGTTGAGCTTCTTGAAAGCGTACAATGGCAGCTTCGACCCTGGAAGGCAGCAGTTG
 
. : . : . : . : . : . :
JMFS139F09+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAA
JMFS060F09+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFN002C04+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS022B09+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS002D10+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFN028H01+ GCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS074F08+ CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS110D09+ GCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS076C06+ ACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS042F02+ AGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCT-T
JMFS147F09+ CAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS111A03+ GAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFS132E01+ GAACAGATCCCTCCTCCCCCTC-TCCTTT
JMFS085B10+ GCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
JMFF041I23+ CAGATCCCTCCTCCCCCTCTTCCTNT
JMFF045A16+ GAACAGATCCCTCCTCCCCCTCTTCCTTN
JMFS148G01+ AGATCCCTCCTCCCCCTCTTCCTTT
JMFS096H06+ CAGATCCCTCCTCCCCCTCTTCCTTT
JMFS017G04+ TT
JMFS082F07+ CAGATCCCTCCTCCCCCTCTTCCTTT
JMSF035K20+ TCCTTT
JMSF038I18+ T
JMSF031L03+ CGAACAGATCCCTCCTCCCCTTCTTCCTTT
JMSF030G18+ T
                      ____________________________________________________________
consensus CGGAGGCAGTTCCGACCGCATCCGGCGCCGCGAACAGATCCCTCCTCCCCCTCTTCCTTT
 
. : . : . : . : . : . :
JMFS060F09+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFN002C04+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS022B09+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS002D10+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFN028H01+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS074F08+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS110D09+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS076C06+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS042F02+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS147F09+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS111A03+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS132E01+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS085B10+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS132E02+ AACGTGTGGACCCTCTTAATCCTCAGCATCATCGAAGGCGACATG
JMFF041I23+ TGGAAATTGGAAACCAACGTGNGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFF045A16+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS148G01+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS096H06+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS017G04+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFS082F07+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMSF035K20+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMSF038I18+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFF037N12+ AATCCTCAGCATCATCGAAGACGACATG
JMFF035G14+ CCTCAGCATCATCGAAGACGACATG
JMFF004P23+ CTCAGCATCATNGAAGACGACATG
JMSF031L03+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
JMFF016M14+ CCTCAGCATCATCGAAGACGACATG
JMFF012H15+ CCTCAGCATCATCGAAGACGACATG
JMSF030G18+ TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCNTCAGCATCATCGAAGACGACATG
JMSF047M03+ CCTCAGCATCATCGAAGACGACATG
JMFF034E01+ TCAGCATCATCGAAGACGACATG
JMFF019B02+ TCAGCATCATCGAAGACGACATG
JMFF013N16+ TCAGCATCATCGAAGACGACATG
JMFS022G07+ ATG
                      ____________________________________________________________
consensus TGGAAATTGGAAACCAACGTGGGGACCCTCTTAATCCTCAGCATCATCGAAGACGACATG
 
. : . : . : . : . : . :
JMFS060F09+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFN002C04+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS022B09+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS002D10+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFN028H01+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS074F08+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS110D09+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS076C06+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS042F02+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS147F09+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS111A03+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS132E01+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS085B10+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS132E02+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF041I23+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF045A16+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS148G01+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS096H06+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS017G04+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS082F07+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMSF035K20+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMSF038I18+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF037N12+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF035G14+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF028H23+ ACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF004P23+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF024P18+ TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF027M04+ CTTAGAAAATACTTGTA
JMFF020F20+ AATCTTAGAAAATACTTGTA
JMFF004P21+ GGTAATTGAAATCGAGATCGGTTTTGGTTGAATCTTAGAAAATACTTGTA
JMSF031L03+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF016M14+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF012H15+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMSF030G18+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMSF047M03+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF034E01+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF019B02+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF013N16+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFF022E16+ TCTTAGAAAATACTTGTA
JMFF022K08+ TCTTAGAAAATACTTGTA
JMFF005H14+ TCTTAGAAAATACTTGTA
JMFF035O03+ TCTTAGAAAATACTTGTA
JMFF020O20+ TCTTAGAAAATACTTGTA
JMFS022G07+ TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
JMFS106C07+ TCTTAGAAAATACTTGTA
                      ____________________________________________________________
consensus TTTTTGGACGGGTAATTGAAATCGAGATCGG-TTTGGTTGAATCTTAGAAAATACTTGTA
 
. : . : . : . : . : . :
JMFS060F09+ GAATAGAAGATTACAAGGAAA
JMFN002C04+ GAATAGAAGATTACAAGGAAAGCAAGAA
JMFS022B09+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS002D10+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFN028H01+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS074F08+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS110D09+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS076C06+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS042F02+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS147F09+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS111A03+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS132E01+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS085B10+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS132E02+ GAATAGCAGATCACAAGGAAAGCAAGAATTGGATCAAGAAAAAGAAGGAAAGTGGGGGAA
JMFF041I23+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF045A16+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS148G01+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS096H06+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS017G04+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS082F07+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMSF035K20+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMSF038I18+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF037N12+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF035G14+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF028H23+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF004P23+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF024P18+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF027M04+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF020F20+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF024H07+ AATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFN013K01+ TACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF004P21+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF006E19+ AATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMSF031L03+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF016M14+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF012H15+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMSF030G18+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMSF047M03+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF034E01+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF019B02+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF013N16+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF022E16+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF022K08+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF005H14+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF035O03+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFF020O20+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS022G07+ GAATAGAAGATTTCAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS116A03+ CAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
JMFS106C07+ GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
                      ____________________________________________________________
consensus GAATAGAAGATTACAAGGAAAGCAAGAATTGGAACAAGAAAAAGAAAAAAAGTGGGGGAA
 
. : . : . : . : . : . :
JMFS022B09+ GCTAACTAACAGACGCTA
JMFS002D10+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCACCGGCGAGG
JMFN028H01+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS074F08+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS110D09+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS076C06+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS042F02+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS147F09+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS111A03+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS132E01+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS085B10+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS132E02+ GCTAACTAACAGACGTTACAGTACTGGATGAGGAAGAGGTAAGAACCGCCGCCGGCGAGA
JMFF041I23+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF045A16+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS148G01+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS096H06+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS017G04+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS082F07+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMSF035K20+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMSF038I18+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF037N12+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF035G14+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF028H23+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF004P23+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF024P18+ GNTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF027M04+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF020F20+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF024H07+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFN013K01+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF004P21+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF006E19+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMSF031L03+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF016M14+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF012H15+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMSF030G18+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMSF047M03+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF034E01+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF019B02+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF013N16+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF022E16+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF022K08+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF005H14+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCNGCGAGG
JMFF035O03+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFF020O20+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS022G07+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS116A03+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
JMFS106C07+ GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
                      ____________________________________________________________
consensus GCTAACTAACAGACGCTACACTACTGGATGAGGAAGAGGGAAGAACCGCCGCCGGCGAGG
 
. : . : . : . : . : . :
JMFS002D10+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFN028H01+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS074F08+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS110D09+ AAGAGGAGGTCGG-AGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS076C06+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS042F02+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS147F09+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS111A03+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS132E01+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS085B10+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS132E02+ AAGAGGAGGTCGGAAGGACTCCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF041I23+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF045A16+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS148G01+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS096H06+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS017G04+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS082F07+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMSF035K20+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMSF038I18+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF037N12+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF035G14+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF028H23+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF004P23+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF024P18+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF027M04+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF020F20+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF024H07+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFN013K01+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF025K23+ CCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS082F09+ GCACCTCGGCCACCGTTAGGC
JMFF004P21+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF006E19+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMSF031L03+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF016M14+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF012H15+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMSF030G18+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMSF047M03+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF034E01+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF019B02+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF013N16+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF022E16+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF022K08+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF005H14+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF035O03+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFF020O20+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS022G07+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS116A03+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
JMFS106C07+ AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
                      ____________________________________________________________
consensus AAGAGGAGGTCGGAAGGACTGCCGCCTTCGGAGGGGAGAGCACCACGGCCACCGTGAGGC
 
. : . : . : . : . : . :
JMFS002D10+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFN028H01+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS074F08+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS110D09+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS076C06+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS042F02+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS147F09+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS111A03+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS132E01+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS085B10+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS132E02+ GAAGGGATGTTGGATTCGCTCAGACAACTCCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF041I23+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF045A16+ GAAGGGATGTTGGATTCGCTCAGACAA--CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS148G01+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS096H06+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS017G04+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS082F07+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF035K20+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF038I18+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF037N12+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF035G14+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF028H23+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF004P23+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF024P18+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF027M04+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF020F20+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF024H07+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFN013K01+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF025K23+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS082F09+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF004P21+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF006E19+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF031L03+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF016M14+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF012H15+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF030G18+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF047M03+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF034E01+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF019B02+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMSF019F08+ GAAGGGATGTTGGATTCGNTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF013N16+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF022E16+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF022K08+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF005H14+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF035O03+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFF020O20+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS022G07+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS116A03+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
JMFS106C07+ GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
                      ____________________________________________________________
consensus GAAGGGATGTTGGATTCGCTCAGACAAC-CCTTGCGACGTAGAGCCCGCAGGCCATAAAG
 
. : . : . : . : . : . :
JMFN028H01+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS074F08+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS110D09+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS076C06+ GGGTAGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS042F02+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS147F09+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS111A03+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS132E01+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS085B10+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS132E02+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAATCGTGTCTCACCTGGGGAT
JMFF041I23+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF045A16+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS148G01+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS096H06+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS017G04+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS082F07+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF035K20+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF038I18+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF037N12+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF035G14+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF028H23+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF004P23+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF024P18+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF027M04+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF020F20+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF024H07+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFN013K01+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF025K23+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGANGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS082F09+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF004P21+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF006E19+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF031L03+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF016M14+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF012H15+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF030G18+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF047M03+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF034E01+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF019B02+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMSF019F08+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF027B10+ TACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF013N16+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF022E16+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF022K08+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF005H14+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF035O03+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFF020O20+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS022G07+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS116A03+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
JMFS106C07+ GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
                      ____________________________________________________________
consensus GGGTCGCCGGTTTACTCCGTGTATAGCCGTGATGTCTACAA-CGTGTCTCACCTGGGGAT
 
. : . : . : . : . : . :
JMFN028H01+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS074F08+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS110D09+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS076C06+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS042F02+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS147F09+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS111A03+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS132E01+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS085B10+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS132E02+ TCACCCCTTGCCCACCTCTCA
JMFF041I23+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF045A16+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS148G01+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS096H06+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS017G04+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS082F07+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF035K20+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF038I18+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF037N12+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF035G14+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF028H23+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF004P23+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF024P18+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF027M04+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF020F20+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF024H07+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFN013K01+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF025K23+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS082F09+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF004P21+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF006E19+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF031L03+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF016M14+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCCAAAAAAACAAATCAAAACCA
JMFF012H15+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF030G18+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF047M03+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF034E01+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF019B02+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMSF019F08+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF027B10+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF013N16+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF022E16+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF022K08+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF005H14+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF035O03+ TCACCCCTTGCCCACCTCTCAAAAATACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFF020O20+ TCACCCCTTGCCCACCTCTCAAAAATACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS022G07+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS116A03+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
JMFS106C07+ TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
                      ____________________________________________________________
consensus TCACCCCTTGCCCACCTCTCAAAACTACAATAAAATACCC-AAAAAACAAATCAAAACCA
 
. : . : . : . : . : . :
JMFN028H01+ AACGATTCCTCGCAGG
JMFS074F08+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS110D09+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS076C06+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS042F02+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS147F09+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS111A03+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS132E01+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS085B10+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF041I23+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF045A16+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS148G01+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS096H06+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS017G04+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS082F07+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF035K20+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF038I18+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF037N12+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF035G14+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF028H23+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF004P23+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF024P18+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF027M04+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF020F20+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF024H07+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFN013K01+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF025K23+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS082F09+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF004P21+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF006E19+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF031L03+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF016M14+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF012H15+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF030G18+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF047M03+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF034E01+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF019B02+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMSF019F08+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF027B10+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF013N16+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF022E16+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF022K08+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF005H14+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF035O03+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFF020O20+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS022G07+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS116A03+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
JMFS106C07+ AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
                      ____________________________________________________________
consensus AACGATTCCTCGCAGGCTACCCACAAATCCTCAGTCACTATTAACCAATTCAAGAATTTA
 
. : . : . : . : . : . :
JMFS074F08+ TGTATTCAAGGGAAGGGATGATTCTG
JMFS110D09+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGA
JMFS076C06+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGG
JMFS042F02+ TGTATTCAAGGGAAGGGATGATTCTGAA
JMFS147F09+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTG
JMFS111A03+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGA
JMFS132E01+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGA
JMFS085B10+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGA
JMFF041I23+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF045A16+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS148G01+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS096H06+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGA
JMFS017G04+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS082F07+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMSF035K20+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMSF038I18+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF037N12+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF035G14+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF028H23+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF004P23+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF024P18+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF027M04+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF020F20+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF024H07+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFN013K01+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF025K23+ TGTATTCAAGGGAAGGGATGATTNTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS082F09+ TGTATTCAAGGGAAGGGATGATTCTGAAGATAAGATGGTTTTTGGTGGGTGCGATGA
JMFF004P21+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF006E19+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMSF031L03+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF016M14+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF012H15+ TGTATTCAAGGGAAGGGATGATTCTGAAGAT
JMSF030G18+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMSF047M03+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF034E01+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF019B02+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMSF019F08+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF027B10+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF013N16+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF022E16+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF022K08+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF005H14+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF035O03+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFF020O20+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS022G07+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS116A03+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
JMFS106C07+ TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
                      ____________________________________________________________
consensus TGTATTCAAGGGAAGGGATGATTCTGAAGATGAGATGGTTTTTGGTGGGTGCGATGAGAG
 
. : . : . : . : . : . :
JMFF041I23+ AAGGCGAATATGAGTGC
JMFF045A16+ AAGGCGAATATGAGTGC
JMFS148G01+ AAGGC
JMFS017G04+ AAGG
JMFS082F07+ AAGGC
JMSF035K20+ AAGGCGAATATGAGTGC
JMSF038I18+ AAGGCGAATATGAG
JMFF037N12+ AAGGCGAATATGAGTGC
JMFF035G14+ AAGGCGAATATGAGTGC
JMFF028H23+ AAGGCGAATATGAGTGC
JMFF004P23+ AAGGCGAATATGAGTGC
JMFF024P18+ AAGGCGAATATGAGTGC
JMFF027M04+ AAGGCGAATATGAGTGC
JMFF020F20+ AAGGCGAATAT
JMFF024H07+ AAGGCGAATATGAGTGC
JMFN013K01+ AAGGCGA
JMFF025K23+ AAGGNGAATATGAG
JMFF004P21+ AAGGCGAATATGAGTGC
JMFF006E19+ AAGGCGAATATGAGT
JMSF031L03+ AAGGCGAATATGAGTGC
JMFF016M14+ AAGGCGAATATGAGTGC
JMSF030G18+ AAGGCGAATATGAGTGC
JMSF047M03+ AAGGCGAATATGAGTGC
JMFF034E01+ AAGGCGAATATGAGTGCGAG
JMFF019B02+ AAGGCGAATATGAGTGC
JMSF019F08+ AAGGCGAATATGAGTGC
JMFF027B10+ AAGGCGAATATGAGTGCGAG
JMFF013N16+ AAGGCGAATATGAGTGCGAGGAGAGAAGAGGAGGCAAAGGGTGTT
JMFF022E16+ AAGGCGAATATGAGTGC
JMFF022K08+ AAGGCGAATATGAGTGC
JMFF005H14+ AAGGCGAATATGAGTGC
JMFF035O03+ AAGGCGAATATGAGTGC
JMFF020O20+ AAGGCGAATATGAGTGC
JMFS022G07+ AAGGCGAATATGAGTGCGAGGAGAGAAGAGGAGGCAAAGGGTGTTAATATATACGAAGAG
JMFS116A03+ AAGGCGAATATGAGTGCGAGGAGAGAAGAGGAGGCAAAGGGTGTTAATATATACGAAGAG
JMFS106C07+ AAGGCGAATATGAGTGCGAGGAGAGAAGAGGAGGCAAAGGGTGTTAATATATACGAAGAG
                      ____________________________________________________________
consensus AAGGCGAATATGAGTGCGAGGAGAGAAGAGGAGGCAAAGGGTGTTAATATATACGAAGAG
 
. : . : . : . : . : . :
JMFS022G07+ ATAAGGGGAAGCGAGGAGTTGTGGTTGTGATTTC
JMFS116A03+ ATAAGGGGAAGCGAGGAGTTGTGGTTGTGATTTCGCCGGATCG
JMFS106C07+ ATAAGGGGAAGCGAGGAGTTGTGGTTGTGATTTCGCCGGATCGGTGTAGTGTGAGATGAG
                      ____________________________________________________________
consensus ATAAGGGGAAGCGAGGAGTTGTGGTTGTGATTTCGCCGGATCGGTGTAGTGTGAGATGAG