Previous Contig 003736:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS105E12Sequence618003736 (3)gb:AF178967_17747305e-85Arabidopsis thaliana pTOR (TOR) mRNA, TOR-1 allele, complete cds.
JMFS125C10Sequence555003736 (3)gb:AF178967_17747309e-66Arabidopsis thaliana pTOR (TOR) mRNA, TOR-1 allele, complete cds.
JMFS125D10Sequence576003736 (3)gb:AF178967_17747304e-88Arabidopsis thaliana pTOR (TOR) mRNA, TOR-1 allele, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS105E12+ GTTCTTGACAGGTCACTGG
                      ____________________________________________________________
consensus GTTCTTGACAGGTCACTGG
 
. : . : . : . : . : . :
JMFS125D10+ TAAAAGCTTCC-TACGCTTTTGNATCCTCACCAAGTGAATATT
JMFS125C10+ ACGCTTTTG-ATCCTCACCAAGTGAATATT
JMFS105E12+ CAAGCTCCTGTAGCCTATAAAAGCTTCCTTACGCTTTTG-ATCCTCACCAAGTGAATATT
                      ____________________________________________________________
consensus CAAGCTCCTGTAGCCTATAAAAGCTTCCTTACGCTTTTG-ATCCTCACCAAGTGAATATT
 
. : . : . : . : . : . :
JMFS125D10+ GGTATTTAAGGTACGCTAGCATCACTTGAGGGGGGCCATGATACCGCATTGTTTCAGGAG
JMFS125C10+ GGTATTTAAGGTACGCTAGCATCACTTGAGGGGGGCCATGATACCGCATTGTTTCAGGAG
JMFS105E12+ GGTATTTAAGGTACGCTAGCATCACTTGAGGGGGGCCATGATACCGCATTGTTTCAGGAG
                      ____________________________________________________________
consensus GGTATTTAAGGTACGCTAGCATCACTTGAGGGGGGCCATGATACCGCATTGTTTCAGGAG
 
. : . : . : . : . : . :
JMFS125D10+ ATGTTTCAGGATCAAACTGCAAGAGTTTAACTAATGTAGATCTAGCCTGACTAATTCTGC
JMFS125C10+ ATGTTTCAGGATCAAACTGCAAGAGTTTAACTAATGTAGATCTAGCCTGAGTAATTCTGC
JMFS105E12+ ATGTTTCAGGATCAAACTGCAAGAGTTTAACTAATGTAGATCTAGCCTGACTAATTCTGC
                      ____________________________________________________________
consensus ATGTTTCAGGATCAAACTGCAAGAGTTTAACTAATGTAGATCTAGCCTGACTAATTCTGC
 
. : . : . : . : . : . :
JMFS125D10+ CGCTCTTACGGCAAAGATTGGCAAACTTAATCCATGTTTCAGAATCTTCTGTTGGAGGTA
JMFS125C10+ CGCTCTTACGGCAAAGATTGGCAAACTTAATCCATGTTTCAGAATCTTCTGTTGGAGGTA
JMFS105E12+ CGCTCTTACGGCAAAGATTGGCAAACTTAATCCATGTTTCAGAATCTTCTGTTGGAGGTA
                      ____________________________________________________________
consensus CGCTCTTACGGCAAAGATTGGCAAACTTAATCCATGTTTCAGAATCTTCTGTTGGAGGTA
 
. : . : . : . : . : . :
JMFS125D10+ AAACAAGTGCCCTGACAGCTAAAAGTCCTTGCCAAACCTCAACATTTCTTTTTGTGCCTT
JMFS125C10+ AAACAAGTGCCCTGACAGCTAAAAGTCCTTGCCAAACCTCAACATTTCTTTTTGTGCCTT
JMFS105E12+ AAACAAGTGCCCTGACAGCTAAAAGTCCTTGCCAAACCTCAACATTTCTTTTTGTGCCTT
                      ____________________________________________________________
consensus AAACAAGTGCCCTGACAGCTAAAAGTCCTTGCCAAACCTCAACATTTCTTTTTGTGCCTT
 
. : . : . : . : . : . :
JMFS125D10+ TTATGCGCTCATTCCACATATTGCGAATAAGGGCCCTCTTTCCCTCGGAAACAGGATTTC
JMFS125C10+ TTATGCGCTCATTCCACATATTGCGAATAAGGGCCCTCTTTCCCTCGGAAACAGGATTTC
JMFS105E12+ TTATGCGCTCATTCCACATATTGCGAATAAGGGCCCTCTTTCCCTCGGAAACAGGATTTC
                      ____________________________________________________________
consensus TTATGCGCTCATTCCACATATTGCGAATAAGGGCCCTCTTTCCCTCGGAAACAGGATTTC
 
. : . : . : . : . : . :
JMFS125D10+ CAACAGGAAGTGTACAATATTCTATAACCTCTTCTAATTCAGAGAGCTGCTGAACACGAA
JMFS125C10+ CAACAGGAAGTGTGCAATATTCTATAACCTCTTCTAATTCAGAGAGTTGCTGAACTAGGC
JMFS105E12+ CAACAGGAAGTGTACAATATTCTATAACCTCTTCTAATTCAGAGAGCTGCTGAACACGAA
                      ____________________________________________________________
consensus CAACAGGAAGTGTACAATATTCTATAACCTCTTCTAATTCAGAGAGCTGCTGAACACGAA
 
. : . : . : . : . : . :
JMFS125D10+ CCATATTGCTATATGCACGTTCATAACTTTCAAGAACCAATGCAGCAAGTTCCGTA
JMFS125C10+ CCCTTTGTATATATGAACGTTCATAACTTTCAAGAACCAATGCAGCAAGATCCGTA
JMFS105E12+ CCATATTGCTATATGCACGTTCATAACTTTCAAGAACCAATGCAGCAAGTTCCGTAGCCA
                      ____________________________________________________________
consensus CCATATTGCTATATGCACGTTCATAACTTTCAAGAACCAATGCAGCAAGTTCCGTAGCCA
 
. : . : . : . : . : . :
JMFS105E12+ AACATTTTCTTGCTCTCTCAACATATTCACGAGCTTCATCATACTTCCCCCGGCGAACTA
                      ____________________________________________________________
consensus AACATTTTCTTGCTCTCTCAACATATTCACGAGCTTCATCATACTTCCCCCGGCGAACTA
 
. : . : . : . : . : . :
JMFS105E12+ GTAGAACAGCCCTAAAAAATGTTCCACTACTACTTCCATCACCACTAGCAGTAGTATTTC
                      ____________________________________________________________
consensus GTAGAACAGCCCTAAAAAATGTTCCACTACTACTTCCATCACCACTAGCAGTAGTATTTC