Previous Contig 003728:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS105A04Sequence615003728 (3)gb:AP003206_18251535e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMFS160A05Sequence541003728 (3)pir|B86473|B864739e-84113.9K hypothetical protein T9I1.1 - Arabidopsis thaliana>gb:AE005172_892288 Ara
JMFS167C09Sequence614003728 (3)gb:AP003206_18251532e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS160A05+ AGCATAGAGCAACTCT
                      ____________________________________________________________
consensus AGCATAGAGCAACTCT
 
. : . : . : . : . : . :
JMFS160A05+ TCAATAGGATCTTCATAGGATTGCTCCCTATTTGAAACAAATCCTTCGAGCCTGGAAACT
                      ____________________________________________________________
consensus TCAATAGGATCTTCATAGGATTGCTCCCTATTTGAAACAAATCCTTCGAGCCTGGAAACT
 
. : . : . : . : . : . :
JMFS160A05+ TTAAAACGATCATCGGGATAGACAGAAACATCAAAATAGACCAGTCCCCGTCGATAAAGT
                      ____________________________________________________________
consensus TTAAAACGATCATCGGGATAGACAGAAACATCAAAATAGACCAGTCCCCGTCGATAAAGT
 
. : . : . : . : . : . :
JMFS160A05+ CCCTTTATCACTTCAGGGTCAAAAAGAATGAAGGAATTCACTTCCTCCTTACATATTTTA
                      ____________________________________________________________
consensus CCCTTTATCACTTCAGGGTCAAAAAGAATGAAGGAATTCACTTCCTCCTTACATATTTTA
 
. : . : . : . : . : . :
JMFS160A05+ TCAATTGTTGCCATTTCTTCTTCTGTCAGTTTCTTAAATTCTTCCAAAGTAAAGTTGACA
                      ____________________________________________________________
consensus TCAATTGTTGCCATTTCTTCTTCTGTCAGTTTCTTAAATTCTTCCAAAGTAAAGTTGACA
 
. : . : . : . : . : . :
JMFS160A05+ AGACAAACTCCCCACCATGGCTCAATAACAAAGTCCACTGGTTGAGTAGGCAATAGTTCT
                      ____________________________________________________________
consensus AGACAAACTCCCCACCATGGCTCAATAACAAAGTCCACTGGTTGAGTAGGCAATAGTTCT
 
. : . : . : . : . : . :
JMFS160A05+ CTTGCAATTGATTTATTCAGCTTCCACATTATTTTCTTAGATTTGCACTTGTTCATAATG
JMFS167C09+ CACTTATTCATAATG
                      ____________________________________________________________
consensus CTTGCAATTGATTTATTCAGCTTCCACATTATTTTCTTAGATTTGCACTTGTTCATAATG
 
. : . : . : . : . : . :
JMFS160A05+ TCAATAAATTCGTTTCTTCCAATCCCAGTAAGCCGCAAGGCATCTGCAGCGCTAAAATTT
JMFS167C09+ TCAATGAATTCATTTCTTCCAAAACCAGCGAGACGCAGTGCATCTGCAGCACTAAAATTT
                      ____________________________________________________________
consensus TCAATGAATTCGTTTCTTCCAATCCCAGTGAGCCGCAGTGCATCTGCAGCGCTAAAATTT
 
. : . : . : . : . : . :
JMFS160A05+ GGGATGCTATAATAAGGTTGTTCATTTTTCATGACTTCAAATATCATATCGCAGTAGTAT
JMFS167C09+ GGGATGCTGTCATAAGGTTGCTCATTTTTCATAACTTCAAATAACATATCACAGTAGTAT
JMFS105A04+ ATATCACAGTAGTAT
                      ____________________________________________________________
consensus GGGATGCTGTCATAAGGTTGTTCATTTTTCATGACTTCAAATATCATATCACAGTAGTAT
 
. : . : . : . : . : . :
JMFS160A05+ CTGAAAGGAGACACCCTCATCACGCGGCAAA
JMFS167C09+ CTGAAAGGAGACACCCGCATCACACGGCAAATGTACTCAGCAAGATGATACGGAAACAAC
JMFS105A04+ CTGAAAGGAGACACCCGCATCACACGGCAAATGTACTCAGCAAGATGATACGGAAACAAC
                      ____________________________________________________________
consensus CTGAAAGGAGACACCCGCATCACACGGCAAATGTACTCAGCAAGATGATACGGAAACAAC
 
. : . : . : . : . : . :
JMFS167C09+ GCTAAATTCCTTCGGAGATACCGCATCATTTCTTCATAGTATTCACCTTCTTTGCATACT
JMFS105A04+ GCTAAATTCCTTCGGAGATACCGCATCATTTCTTCATAGTATTCACCTTCTTTGCATACT
                      ____________________________________________________________
consensus GCTAAATTCCTTCGGAGATACCGCATCATTTCTTCATAGTATTCACCTTCTTTGCATACT
 
. : . : . : . : . : . :
JMFS167C09+ TTACGAGCAAAACAACTGTTCCATTGGAGTCTCCTCTTTAAGCAATGGTCGATTATCCTT
JMFS105A04+ TTACGAGCAAAACAACTGTTCCATTGGAGTCTCCTCTTTAAGCAATGGTCGATTATCCTT
                      ____________________________________________________________
consensus TTACGAGCAAAACAACTGTTCCATTGGAGTCTCCTCTTTAAGCAATGGTCGATTATCCTT
 
. : . : . : . : . : . :
JMFS167C09+ CTGTGCCATTCTTCCGTGGAATTCAAAGTAGCTTGAAGCCGCTTTGGAAGGTTTTCCCAA
JMFS105A04+ CTGTGCCATTCTTCCGTGGAATTCAAAGTAGCTTGAAGCCGCTTTGGAAGGTTTTCCCAA
                      ____________________________________________________________
consensus CTGTGCCATTCTTCCGTGGAATTCAAAGTAGCTTGAAGCCGCTTTGGAAGGTTTTCCCAA
 
. : . : . : . : . : . :
JMFS167C09+ GGGCATTCTTCCTTGAT
JMFS105A04+ GGGCATTCTTCCTTGATCGCTTTTAGTATAAGCTGGTCTTCTAAAGTCGTCGGAGCGTGG
                      ____________________________________________________________
consensus GGGCATTCTTCCTTGATCGCTTTTAGTATAAGCTGGTCTTCTAAAGTCGTCGGAGCGTGG
 
. : . : . : . : . : . :
JMFS105A04+ TGCATTTTAAAATCCTCAGCAGATCACTCAAATATCTACACTACACAACCGCATAGTCCC
                      ____________________________________________________________
consensus TGCATTTTAAAATCCTCAGCAGATCACTCAAATATCTACACTACACAACCGCATAGTCCC
 
. : . : . : . : . : . :
JMFS105A04+ TGCAAATGATCTTGAAAAACCGAATAATTCAATACCATCTAGGAATATCTCATATCCAAT
                      ____________________________________________________________
consensus TGCAAATGATCTTGAAAAACCGAATAATTCAATACCATCTAGGAATATCTCATATCCAAT
 
. : . : . : . : . : . :
JMFS105A04+ CATAGGAAATTGGAACGGAAATGAAATTCCAATCCTGGATCGCACTGCATTTCGATTTTT
                      ____________________________________________________________
consensus CATAGGAAATTGGAACGGAAATGAAATTCCAATCCTGGATCGCACTGCATTTCGATTTTT
 
. : . : . : . : . : . :
JMFS105A04+ TTTTCTCCGAATTTTCTACGGCTACAGGAATTGACTGAACAGAAAGAACACAGTTAAAAT
                      ____________________________________________________________
consensus TTTTCTCCGAATTTTCTACGGCTACAGGAATTGACTGAACAGAAAGAACACAGTTAAAAT
 
. : . : . : . : . : . :
JMFS105A04+ AAAAAACTTCACCGGAATTTCGGAATCGAGTAGAGCCGTTCCGGCGATGATTAGAGGTTT
                      ____________________________________________________________
consensus AAAAAACTTCACCGGAATTTCGGAATCGAGTAGAGCCGTTCCGGCGATGATTAGAGGTTT