Previous Contig 003725:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051B23Sequence630003725 (25)502003270 (9)gb:AE005173_8928011e-20Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC020889_153
JMFS008D05Sequence599003725 (25)sp|O04379|AGO1_ARATH1e-73Argonaute protein.>gb:ATU91995_1557385 Arabidopsis thaliana Argonaute protein (A
JMFS067A06Sequence619003725 (25)gb:OSJN00155_16958082e-89Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0005N02, complete seque
JMFS071B06Sequence597003725 (25)gb:AE005173_8928016e-42Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC020889_153
JMFS079B10Sequence615003725 (25)sp|O04379|AGO1_ARATH1e-66Argonaute protein.>gb:ATU91995_1557385 Arabidopsis thaliana Argonaute protein (A
JMFS079E08Sequence553003725 (25)gb:AE005173_8928010.036Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC020889_153
JMFS081C06Sequence507003725 (25)pir|S53522|S535220.033crystallin beta B1 - chicken
JMFS088F10Sequence539003725 (25)
JMFS095G09Sequence454003725 (25)
JMFS102B11Sequence560003725 (25)
JMFS104G11Sequence598003725 (25)
JMFS108E01Sequence522003725 (25)gb:AY383688_11781110.046Rattus norvegicus LRRGT00033 mRNA, complete cds.
JMFS124D11Sequence573003725 (25)sp|O04379|AGO1_ARATH1e-60Argonaute protein.>gb:ATU91995_1557385 Arabidopsis thaliana Argonaute protein (A
JMFS128B11Sequence617003725 (25)gb:OSJN00155_16958088e-94Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0005N02, complete seque
JMFS133H11Sequence474003725 (25)
JMFS146E11Sequence604003725 (25)
JMFS148B06Sequence391003725 (25)
JMFS152H12Sequence473003725 (25)gb:AP003236_18259290.046Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P004
JMFS156B02Sequence256003725 (25)
JMFS156C04Sequence400003725 (25)
JMFS160E01Sequence408003725 (25)gb:AF357910_12651060.011Sarcocystis muris putative microneme protein Sm70 mRNA, partial cds.
JMFS160F01Sequence380003725 (25)
JMFS163F03Sequence619003725 (25)
JMFS168D06Sequence569003725 (25)
JMSF032H24Sequence708003725 (25)gb:AE005173_8928013e-04Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC020889_153631003270 (9)sp|O04379|AGO1_ARATH3e-81Argonaute protein.>gb:ATU91995_1557385 Arabidopsis thaliana Argonaute protein (A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067A06+ TGCACACCTCCATTGGCAAGTAATT
                      ____________________________________________________________
consensus TGCACACCTCCATTGGCAAGTAATT
 
. : . : . : . : . : . :
JMFS067A06+ AGCCCTCTGCTGATTCCCAACTTGTAGACATGGCCATTGAGTATGCTGAATGACAAAACC
                      ____________________________________________________________
consensus AGCCCTCTGCTGATTCCCAACTTGTAGACATGGCCATTGAGTATGCTGAATGACAAAACC
 
. : . : . : . : . : . :
JMFS067A06+ ATAAGTCTCACGGAAGTATTCAACAACAGATTTAGTTGTACCCATCTCATCAACAGGAAA
                      ____________________________________________________________
consensus ATAAGTCTCACGGAAGTATTCAACAACAGATTTAGTTGTACCCATCTCATCAACAGGAAA
 
. : . : . : . : . : . :
JMFS067A06+ GGTCAGCTCCCTTGTTGCTTGTGAAGTCAGACCAGAGATTCGATACTTCCTCCGCATGTT
                      ____________________________________________________________
consensus GGTCAGCTCCCTTGTTGCTTGTGAAGTCAGACCAGAGATTCGATACTTCCTCCGCATGTT
 
. : . : . : . : . : . :
JMFS067A06+ ACCACGATGAGTAACCTCTACCTTCACACCTCTTAAAGCTTTCTTAATCTTCACTCTGTC
JMFS128B11+ TCACTCTGTC
                      ____________________________________________________________
consensus ACCACGATGAGTAACCTCTACCTTCACACCTCTTAAAGCTTTCTTAATCTTCACTCTGTC
 
. : . : . : . : . : . :
JMFS067A06+ AGAATCAGACAAAGGTCTAGATGACACATCCCTATTCAGAAGCTGGGTTACAAAATCAAT
JMFS128B11+ AGAATCAGACAAAGGTCTAGATGACACATCCCTATTCAGAAGCTGGGTTACAAAATCAAT
                      ____________________________________________________________
consensus AGAATCAGACAAAGGTCTAGATGACACATCCCTATTCAGAAGCTGGGTTACAAAATCAAT
 
. : . : . : . : . : . :
JMFS067A06+ GACAGGTAGGGGCTCAATAAAAGCTGTGGATGACATATCTATATTCAACGATAAACCCAT
JMFS128B11+ GACAGGTAGGGGCTCAATAAAAGCTGTGGATGACATATCTATATTCAACGATAAACCCAT
                      ____________________________________________________________
consensus GACAGGTAGGGGCTCAATAAAAGCTGTGGATGACATATCTATATTCAACGATAAACCCAT
 
. : . : . : . : . : . :
JMFS067A06+ CTGAGTAGGGCGAATGCTTTGGTAAAAACCACGCCAGCTTTCTAGACCTTCACCCAATGG
JMFS128B11+ CTGAGTAGGGCGAATGCTTTGGTAAAAACCACGCCAGCTTTCTAGACCTTCACCCAATGG
                      ____________________________________________________________
consensus CTGAGTAGGGCGAATGCTTTGGTAAAAACCACGCCAGCTTTCTAGACCTTCACCCAATGG
 
. : . : . : . : . : . :
JMFS067A06+ CTGCCTACGCCCTAGATTTGGGGAATAGAAGGACCGGCCCACTGGGCAATACCTAGATGT
JMFS128B11+ CTGCCTACGCCCTAGATTTGGGGAATAGAAGGACCGGCCCACTGGGCAATACCTAGATGT
JMFS008D05+ AGATGT
                      ____________________________________________________________
consensus CTGCCTACGCCCTAGATTTGGGGAATAGAAGGACCGGCCCACTGGGCAATACCTAGATGT
 
. : . : . : . : . : . :
JMFS067A06+ AGGGAGTTCTCGCAAAACAATATCTAAAACCTGAA
JMFS128B11+ AGGGAGTTCTCGCAAAACAATATCTAAAACCTGAAGTGCTTCTTGAGGTGCATCTGCCTG
JMFS008D05+ AGGGAGTTCTCGCAAAACAATATCTAAAACCTGAAGTGCTTCTTGAGGTGCATCTGCCTG
JMFS079B10+ GCATCTGCCTG
                      ____________________________________________________________
consensus AGGGAGTTCTCGCAAAACAATATCTAAAACCTGAAGTGCTTCTTGAGGTGCATCTGCCTG
 
. : . : . : . : . : . :
JMFS128B11+ CCTGCCTTGTAGAAACATTCCCAAATGATGAAGATCAGCCCGTGATGCCAACTTTATCAC
JMFS008D05+ CCTGCCTTGTAGAAACATTCCCAAATGATGAAGATCAGCCCGTGATGCCAACTTTATCAC
JMFS124D11+ AAACATTCCCAAATGATGAAGATCAGCCCGTGATGCCAACTTTATCAC
JMFS079B10+ CCTGCCTTGTAGAAACATTCCCAAATGATGAAGATCAGCCCGTGATGCCAACTTTATCAC
                      ____________________________________________________________
consensus CCTGCCTTGTAGAAACATTCCCAAATGATGAAGATCAGCCCGTGATGCCAACTTTATCAC
 
. : . : . : . : . : . :
JMFS128B11+ AACTTTAAATTCTTTCTCTCTCCTGGCACCACCTGACTTATCTTCATCATCAATTAGAGT
JMFS008D05+ AACTTTAAATTCTTTCTCTCTCCTGGCACCACCTGACTTATCTTCATCATCAATTAGAGT
JMFS124D11+ AACTTTAAATTCTTTCTCTCTCCTGGCACCACCTGACTTATCTTCATCATCAATTAGAGT
JMFS079B10+ AACTTTAAATTCTTTCTCTCTCCTGGCACCACCTGACTTATCTTCATCATCAATTAGAGT
                      ____________________________________________________________
consensus AACTTTAAATTCTTTCTCTCTCCTGGCACCACCTGACTTATCTTCATCATCAATTAGAGT
 
. : . : . : . : . : . :
JMFS128B11+ AATTCTGAACTCTTTAGAAACAAAAGGGAGAGGACCTGCAGTGTACAGGCTCTTCCTTCC
JMFS008D05+ AATTCTGAACTCTTTAGAAACAAAAGGGAGAGGACCTGCAGTGTACAGGCTCTTCCTTCC
JMFS124D11+ AATTCTGAACTCTTTAGAAACAAAAGGGAGAGGACCTGCAGTGTACAGGCTCTTCCTTCC
JMFS079B10+ AATTCTGAACTCTTTAGAAACAAAAGGGAGAGGACCTGCAGTGTACAGGCTCTTCCTTCC
JMFS071B06+ GGACCTGCAGTGTACAGGCTCTTCCTTCC
                      ____________________________________________________________
consensus AATTCTGAACTCTTTAGAAACAAAAGGGAGAGGACCTGCAGTGTACAGGCTCTTCCTTCC
 
. : . : . : . : . : . :
JMFS128B11+ ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATTCTCTGTACGTTCTAACCAGTTGATC
JMFS008D05+ ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATTCTCTGTACGTTCTAACCAGTTGATC
JMFS124D11+ ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATTCTCTGTACGTTCTAACCAGTTGATC
JMFS079B10+ ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATTCTCTGTACGTTCTAACCAGTTGATC
JMFS071B06+ ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATACTCTGTACGTTCTAACCAGTTGATC
                      ____________________________________________________________
consensus ATCATATGCTGGAAGCCTCTTTCCCAGATGAGATTCTCTGTACGTTCTAACCAGTTGATC
 
. : . : . : . : . : . :
JMFS128B11+ CATAACTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
JMFS008D05+ CATAACTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
JMFS124D11+ CATAACTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
JMFS079B10+ CATAACTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
JMFS071B06+ CATATCTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
                      ____________________________________________________________
consensus CATAACTGCACGATTAACACCTCGAGAAGCAACTTCCGGGGTGATTGAAACATCATACTG
 
. : . : . : . : . : . :
JMFS128B11+ GTGCAAG
JMFS008D05+ GTGCAAGTCCTTATCAGGCAGCTCAGCAAAGAAGTGGTTAGCCTTCACCATGCACCTGGT
JMFS124D11+ GTGCAAGTCCTTATCAGGCAGCTCAGCAAAGAAGTGGTTAGCCTTCACCATGCACCTGGT
JMFS079B10+ GTGCAAGTCCTTATCAGGCAGCTCAGCAAAGAAGTGGTTAGCCTTCACCATGCACCTGGT
JMFS071B06+ GTGCAAGTCCTTATCAGGCAGCTCAGCAAAGAAGTGGTTAGCCTTCACCATGCACCTGGT
                      ____________________________________________________________
consensus GTGCAAGTCCTTATCAGGCAGCTCAGCAAAGAAGTGGTTAGCCTTCACCATGCACCTGGT
 
. : . : . : . : . : . :
JMFS008D05+ GCCACTCTTTCCAGGTCCTGGGCGAAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
JMFS124D11+ GCCACTCTTTCCAGGTCCTGGGCGAAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
JMFS079B10+ GCCACTCTTTCCAGGTCCTGGGCGAAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
JMFS071B06+ GCCACTCTTTCCAGGTCCTGGGCGAAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
JMSF032H24+ AAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
                      ____________________________________________________________
consensus GCCACTCTTTCCAGGTCCTGGGCGAAGAGGAAATCTCATTGACTTGCTGGATGCAGGTTG
 
. : . : . : . : . : . :
JMFS008D05+ GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
JMFS124D11+ GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
JMFS079B10+ GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
JMFS071B06+ GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
JMSF032H24+ GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
JMFS081C06+ GTCAGTCAT
JMFS108E01+ AGTCAGTCAT
JMFS079E08+ GTCAGTCAT
JMFS088F10+ TCAGTCAT
JMFS104G11+ CTGCAATAGCTGAGTCAT
                      ____________________________________________________________
consensus GATAGCTTGTGTGGGAGCAGCTTCAGGTTGCAGAGTAAGTTTCTGCAATTGCTGAGTCAT
 
. : . : . : . : . : . :
JMFS008D05+ TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTCCA
JMFS124D11+ TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTCCACTGGCCT
JMFS079B10+ TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTCCACTGGCCT
JMFS071B06+ TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTCCACTGGCCT
JMSF032H24+ TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTCCACTGGCCT
JMFS102B11+ GTCTAGATGAAGAACCAGCATCCACAGAGAGTCGCACTGGCCT
JMFF051B23+ AGATGAAGAACCAGCATCCACAGGAGATTCCACTGGCCT
JMFS081C06+ TTGTGCATGCTCAGAGTGTCTAGATGAAGAACCAGCATCCACAGGAGATTGCACTGGCCT
JMFS108E01+ CTGTGCATGGTCAGAGTGTCTAGATGAAGAACCAGCATCCACAGAGAGTCGCACTGGCCT
JMFS146E11+ ATGAACAACCAGCATCCACAGGAGATTGCAC-GACCT
JMFS079E08+ TTGTGCATGCTAAGAGCGTCTAGATGAAGAACCAGCACTCACAGCAGATTGCACTGGCCT
JMFS088F10+ TTGTGCATGCTCAGAGTGTCTAGATCAAGAACCAGCTCTCACACGAGATTGCACTGGCCT
JMFS104G11+ CTGTGCTTGCTCAGAGTGTCTAGATGAAGAACCAGCATCCACAGGAGATCGCACTGGCCT
                      ____________________________________________________________
consensus TTGTGCTTGCTCAGGTTGTCTAGATGAAGAACCAGCATCCACAGGAGATTGCACTGGCCT
 
. : . : . : . : . : . :
JMFS124D11+ AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTG
JMFS079B10+ AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTGGGTTGCTTGGTGCAG
JMFS071B06+ AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTGGGTTGCTTGGTGCAG
JMSF032H24+ AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTGGGTTGCTTGGTGCAG
JMFS102B11+ AGGATAAGACATGCGCTGAGTTGCAATGGCTTGATATGGAAGCTAGGTAGCTTGGTGCAG
JMFF051B23+ AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTGGGTTGCTTGGTGCAG
JMFS081C06+ AGGATAAGACATGCGCTGAGTTGCTATGGCTTGATATAGAAGCCAGGTAGCTTGGTGCAG
JMFS108E01+ AGTATAAGACATGGGCTGAGGTGCTATGGCTTGATATAGCAGCCAGTGAGCTTGGTGCAG
JMFS146E11+ AGTATAAGACTGGCG-TGAGTTGCAATGGCTTTATATAGAAGCCAGTGAGCTTGGTGCAG
JMFS133H11+ GAAGCCAGGTAGCTTGGTGCAG
JMFS168D06+ TATGGCTTGATA-AGAAGCCAGTGAGCTCGGTGCAG
JMFS079E08+ AGAATAAAACATGGGCTGAGGTGCAATGGCTTGATATAGAAGCCAGGATGCTTGGTGCAG
JMFS088F10+ AGGATAAAACATGCGCTGAGGTGCTATGGCTTTATATAGAAGCTAGGTAGCTTGGTGCAG
JMFS104G11+ AGGATAAGACATGCGCTGAGTTGCAATGGCTTGATATGGAAGCCAGGTTGCTTGGTGCAG
                      ____________________________________________________________
consensus AGGATAAGACATGGGCTGAGTTGCAATGGCTTGATATGGAAGCTAGGTAGCTTGGTGCAG
 
. : . : . : . : . : . :
JMFS079B10+ CTCG
JMFS071B06+ CTC-GGGAACCAGTGGCCTGGAAGGCCCACCACC-AGAAGGTGCCCCACGCC-CACCTAT
JMSF032H24+ CTC-GGGAACCAGTGGCCTGGAAGGCCCACCACC-AGAAGGTGCCCCACGCC-CACCTAT
JMFS095G09+ GGAACCAGTGGCCT-CAAGGCCCACCACC-AGAAGGTGCCCCACGCC-CACGTAT
JMFS102B11+ CTC-GGGAAACAGTGGCCTGTAAGGCCCACCACC-AGAAGGTGCCCCACGCC-CACCTAT
JMFF051B23+ CTC-GGGAACCAGTGGCCTGGAAGGCCCACCACC-AGAAGGTGCCCCACGCC-CACCTAT
JMFS081C06+ CTCAG-GATACAGTGGCCTGCAAGGCCCGCCACC-AGAAGGTGCCCCACGCC-CACCTAT
JMFS108E01+ CTCAGT-ATCCATTGGCCTGCTAGGCCCGCCCCC-AAAAGGTGCCCCACGAC-CACCTAT
JMFS156C04+ CCGCCACC-AGAAGGTGCCCCATGAC-CACCTAT
JMFS146E11+ ATCAAT-ATCCATTGGCCTGCTAGGCCCGCCACC-AAAAGGTGCCCCACGCC-CACCTAT
JMFS152H12+ GCCTGTAAGGCCCGCCCCCAAGAAGGTGCCCCACGAG-CACCTAG
JMFS133H11+ ATCAA-GATACAGTGGCCTGCAAGGCCCGCCACC-AGAAGGTGCCCCACGAC-CACCTAT
JMFS168D06+ CTTAAT-ATCCA-TTGCCTGTACGGCCCGCCACC-AGAAGGTGCCCCACGAC-CACCTAT
JMFS079E08+ CTC-GTGAAACAGTGGCCTGTAAGGACCCCCACC-AGAAGGTGCCCCACGCC-CACCTAG
JMFS088F10+ CTCAATGAAACAGTGGCCTGCTAGGCCCGCCACC-AAAAGGTGCCCCACGACGCACCTAT
JMFS104G11+ CTC-GGGAACCAGTGGCCTGCAAGGCCCGCCACC-AGAAGGTGCCCCACGCC-CACCTAT
                      ____________________________________________________________
consensus CTCAGGGAACCAGTGGCCTGCAAGGCCCGCCACC-AGAAGGTGCCCCACGCC-CACCTAT
 
. : . : . : . : . : . :
JMFS071B06+ GCCACCA-CGGCGCTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMSF032H24+ GCCACCA-CGGCGCTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMFS163F03+ ATGGTGTGTGCAATGGAGATCCCCCACCATTATATT-GCTGAGCAC-CCCTACC
JMFS095G09+ GCCACG---GGGGGTGCAATGGAGCTCCCCCACGATTATATT-GCTGAGCAC-CCCTACC
JMFS102B11+ GCCACCA-CGGCGCTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMFF051B23+ GCCACCA-CGGCGCTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMFS081C06+ GCCACCA-CGGGGGTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMFS160E01+ GTGCAATGGAGCTCCCCCACCAATATATT-GCTGAGCAC-CCCTACC
JMFS108E01+ GCCGCCA-CGGGGGTGCAATGGAGCTCCCCCACCCTGATATT-GCTGAGCAC-CCCTACC
JMFS156C04+ GCCACCA-AGGGTGTGCAATGGTGCTCCCACACGATGATATT-GCTGAGCAC-ACCTACG
JMFS146E11+ GCCACCA-CGGCGGTGCAATGGAGATCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
JMFS152H12+ CTCGCCAT-GGGTGTGCAATGGAGATCCCCCACGATGATACT-GCTGAGCAC-CCCTACC
JMFS160F01+ TGCAATGGAGATCCCCCACCATTATAAT-GCTGAGCAC-CCCTACC
JMFS133H11+ GCCGCCA-CGGGTGTGCAATGGAGATCCCCCACCCTGATATT-GCTGAGCAC-CCCTACC
JMFS168D06+ GCCACCAT-GGGGGTGCAATGGAGCTCCCCCACGATGATATT-GCTGAGCAC-CCCTACC
JMFS079E08+ GCCGCC-TCGGCGCTGCAATGGAGCTCCCCCACGATGATATTGCATGAGCACACCCTACC
JMFS088F10+ GCCGCCATCGGGGGTGCAATGGAGCTCCCCCACGCTGATACT-CATGAGCAC-CCCTACC
JMFS104G11+ GCCACCA-CGGCGCTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CGCTACC
                      ____________________________________________________________
consensus GCCACCA-CGGGGGTGCAATGGAGCTCCCCCACGCTGATATT-GCTGAGCAC-CCCTACC
 
. : . : . : . : . : . :
JMFS071B06+ TTGCTGATACTCAGGGTGTCCATAGGACTGCTGA
JMSF032H24+ TTGCTGATACTCAGGGTGTCCATAGGACTGCTGAGGAGCCATTCCCCCTCGTGGAGCTCC
JMFS163F03+ TCCATGATAATCACGGGGTCCATATTAATCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS095G09+ TTGATGATACTCACGGTGTCCATAGTACTCCTCAGTAACCATTCCCCCTGGTGGAGCTCC
JMFS102B11+ TTGCTGATACTCAGGGTGTCCATAGGACTGCTGAGGAGCCATTCCCCCTCGTGGAGCTCC
JMFF051B23+ TTGCTGATACTCAGGGTGTCCATAGGACTGCTGAGGAGCCATTCCCCCTCGTGGAGCTCC
JMFS081C06+ CTGATGATACTCAGGGGGGCCATAGGACTCCTCAGGAGCCATTCCCCCTGGTGGAGCTCC
JMFS160E01+ TCCATGATACTCAGGGGGGCCATAGTACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS108E01+ TCGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGCCATTCCCCCTCGTGGAGCTCC
JMFS156C04+ TTCATGATATCCAGAGTGTCCATAGAAATCCTCAGGAGCCATTCCCCCTGGTGGAGCTCC
JMFS146E11+ TTGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGCCATTCCCCCTCGTGGAGCTCC
JMFS152H12+ TCGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGACATTCCCCCTGGTGGAGCTCC
JMFS160F01+ CCGATGATACTCAGGGGGTCCATAGGACTCCTCAGTAACCATTCCCCCTGGTGGAGCTCC
JMFS133H11+ CCGATGATACTCAGGGTGGCCATAGGACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS168D06+ CTGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS079E08+ CTGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS088F10+ TTGATGATACTCAGGGGGTCCATAGGACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
JMFS104G11+ TTGCTGATACTCAGGGTGTCCATAGGACTGCTGAGGAGCCATTCCCCCTCGTGGAGCTCC
                      ____________________________________________________________
consensus TTGATGATACTCAGGGTGTCCATAGGACTCCTCAGTAGCCATTCCCCCTGGTGGAGCTCC
 
. : . : . : . : . : . :
JMSF032H24+ ACCACCT-TGGCCACCATGTC-NTCCACGCTGAGGTGCCCAGCCACCTCTTCCTCCTTGG
JMFS163F03+ ACCACGT-TGGCGACCATGTC-ATCCATAGTGAGGTGCCCAGCCACCTCTTCTTCGGTGG
JMFS095G09+ ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTCTTCCTCCGTGG
JMFS156B02- TGTC-CTCCACGCTGAGGTGCCCAGCCACCTCTTCCTCCTTGG
JMFS102B11+ ACCACCT-TGGCCACCATGTC-CTCCACGGTGAGGTGCCCAGCCACCTCTTCCTCCGTGG
JMFF051B23+ ACCACCT-TGGCCACCATGTC-CTCCACGCTGAGGTGCCCAGCCACCTCTTCCTCCTTGG
JMFS148B06+ CACGATGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS081C06+ ACCACGT-TGGCCGCCATGTC-ATCCACGGTGAGGTGCCCAGCCACCTCTTCCTCGGTGG
JMFS160E01+ ACCACGTGTGGCGGCCATGTC-ATCCATAGTGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS108E01+ ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTCTTCTTCGGTGG
JMFS156C04+ ACCACCT-TGGCCACCATGTC-CTCCACATTGAGTCGCCCAGCCACCTCTTCCTCGGTGG
JMFS146E11+ ACCACGT-TGGCCACCATGTCTATCCACAGTGAGGTGCCCAGCCACCTCTTCCTCCGTGG
JMFS152H12+ ACCACGT-TGGCGACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS160F01+ ACCACGT-TGGCGACCATGTC-ATACATAGTGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS133H11+ ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS168D06+ ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTGTTCTTCGGTGG
JMFS079E08+ ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTCTTCCTCCGTGG
JMFS088F10+ ACCACGT-TGGCCGCCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTCTTCTTCGGTGG
JMFS104G11+ ACCACGT-TGGCCACCATGTC-CTCCACGGTGAGGTGCCCAGCCACCTCTTCCTCCGTGG
                      ____________________________________________________________
consensus ACCACGT-TGGCCACCATGTC-ATCCACAGTGAGGTGCCCAGCCACCTCTTCCTCGGTGG
 
. : . : . : . : . : . :
JMSF032H24+ TAGCTACCCTCCTGTTGATGTTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCCTGCTCC
JMFS163F03+ TAGCTACCCTC
JMFS095G09+ TAGGCACCCTCCCGCTGATGATCCTGTGGTGG-GAGTTTAGCTCCACCTCGTCCGGTTCC
JMFS156B02- TAGCTACCCTCCTGTTGATGTTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCCTGCTCC
JMFS102B11+ TAGCTACCCTCCTGTTGATGTTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCCTGTTCC
JMFF051B23+ TAGCTACCCTCCTGTTGATGTTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCCTGCTCC
JMFS148B06+ GAGGTACCTTCCTGTTGATGTGTCTGTGGTGG-GCGTTGAGCACCACCTCGTCGTGCTCC
JMFS081C06+ TAGGTACCCTCCTGTTGATGTTTCTGTGGTGG-GGGTTGAGCAGCTCCTGGTCCTGCTCC
JMFS160E01+ TAGGGACCTTCCTGTTAATGCTTCTGAGGTGG-GCGTTGAGCACCAC
JMFS108E01+ TAGGTTCCTTCCTGTTTATGTTTCTGTGGTGG-GCGTTGAGCAGCTCCTGGTCTTGCTCC
JMFS156C04+ AAGGGACCCTCCTGTTGATGCTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCTTGCTCC
JMFS146E11+ TAGGGACCCTCCTGTTAATGCTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCTTGCTCC
JMFS152H12+ TAGGTACCGTCTTGTTGATGATGATGTGGTGG-GTGTTGAGCTCCACCTCGTCCTGTTTC
JMFS160F01+ TAGG
JMFS133H11+ TAGGTACCGTCTTGTTGATGATGATGTGGTGG-GCGTTGAGCTCCACCTCGTCCTGTTTC
JMFS168D06+ TAGGTACCGTCCTGTTGATGATGATGTGGTGG-GCGTTGAGCACCACCTCGTCCTGTTTC
JMFS079E08+ TAGGTCCCCTCCTGTCCATGATGCTGAGGTGG-GCGATAAGCACCACCTCGTCATGCTCC
JMFS088F10+ TAGGCACCCGCCCGCCCATGCTCTTTTGGTGGCGCGCTGAGCACCACCTGGTCGTGCTAC
JMFS104G11+ TAGCGACCCTCCTGTTCATGTTCCTGTGGTGG-GCGATGAGCACCACCTCGTCCGGCTCC
                      ____________________________________________________________
consensus TAGGTACCCTCCTGTTGATGTTGCTGTGGTGG-GCGTTGAGCACCACCTCGTCCTGCTCC
 
. : . : . : . : . : . :
JMSF032H24+ AGTCT-CCTGAGGATCAGATGACTCACCCCC--ACCA-GGATGTTC-AGT-TCTTC-TCT
JMFS095G09+ AGTCT-CCTAAGGATCAAATGACTCACCCCC--ACCA-GCATGTTC-AGT-TCATC-TCT
JMFS156B02- AGTCT-CCTGAGGATCAGATGACTCACCCCC--ACCA-GGATGTTC-AGT-TCTTC-TCT
JMFS102B11+ AGTCT-CCTGAGGATCAAATGACTCACCCCC--ACCA-GGATGTTC-AGT-TCTTC-TCT
JMFF051B23+ AGTCT-CCTGAGGATCAGATGACTCACCCCC--ACCA-GGATGTTC-AGT-TCTTC-TCT
JMFS148B06+ AGTGT-CCTGAGGATCACATGACTCACCCCC--ACCA-GGATGT
JMFS081C06+ AGTTT-CCTGAGGATCAGATGACTCACCCCC--TGCA-GAATGTTC-AGG-TTTTC-TCT
JMFS108E01+ AGTTT-TCTGAGGATCAGATGACTCACCCCC--TGCA-GAATGTTC-AGT-TTTTC-TCT
JMFS156C04+ AGTGT-CCTCAGGATCAGATTACTCACCCCC--ACCA-GGATGTTCGAGT-TCATC-TCT
JMFS146E11+ AGTGT-CCTCAGGATCAGATTACTCACCCCC--ACCA-GGATGTTC-AGTTTATATATTT
JMFS152H12+ AGTCT-CCTGAGGATCAGATGAGTGACCCCC--AGCA-GGATGGTC-AGT-TAGTGCTCT
JMFS133H11+ AGTCT-CCTGAGGATCAGATGAGTGACCGCAC-AGCA-GGATGGTC-AGT-TATTG-TCT
JMFS168D06+ AGTCT-CCTGAGGATCAGATGACTC-ACCCCC-ACCA-GGATGGTC-AGT-TATTGCTCT
JMFS079E08+ AGTCT-CATGAGAATCAGATGACTCACCTCCCTGCCAGGGATGTTC-AGTATCTTCATCT
JMFS088F10+ AGTCTGCGCTAGGATCGGATCACTCTACCCCC-AACA-GGATGTTC-AGT-TCTTC-TCT
JMFS104G11+ AGTCT-CTTGAGGATCAGATGACTC-ACCCCC-GCGA-GGATGTTC-AGT-TCTTC-TCT
                      ____________________________________________________________
consensus AGTCT-CCTGAGGATCAGATGACTCACCCCC--ACCA-GGATGTTC-AGT-TCTTC-TCT
 
. : . : . : . : . : . :
JMSF032H24+ TTC-TC-ACCATGGTACCT
JMFS095G09+ TTC-TC-CCCATGGAACCTTAAGAACCGCCGCTCTGTACA-AACAGCTTCGTTGGTGGGT
JMFS156B02- TTC-TC-ACCATGGTACCTTAAGAGCCGCCGCTCTCTACA-AACA-CTTCGTTGGTGGGT
JMFS102B11+ TTC-TC-ACCATGGTACCTTAAGAGCCGCCGCTCTCTACA-AACA-CTTCGTTGGTGGGT
JMFF051B23+ TTC-TC-ACCATGGTACCT
JMFS081C06+ TTC-TC-ACCATGGTACATTAAGAGCCTCCGCTCTC
JMFS108E01+ TTC-TC-ACCATGGTACATTAAGAGCCTCCGCT
JMFS156C04+ TTC-TC-GCCATGGTGCCTTA
JMFS146E11+ CTC----GCCATGGTGCCTTAAGAGCCACCGCTCTATACA-ATCA-CTTCGTTGGTGGGT
JMFS152H12+ CTTGTGCGCCATGGTACATTAATAGCCGCCGCTGTGTGCGTGACGTCTTCGTTGGTGGGT
JMFS133H11+ CTTGTC-GCCATGGTACATTAAGAGCCGCCGCTCTGTGCG-AACGTCTTCGTTGGTGGGT
JMFS168D06+ CTTCTC-ACCATGGTACATTAAGAGCCGCCGCTCTGTACA-AACATCTTCGTTGGTGGGT
JMFS079E08+ TTCATCAGCCATGGAACATTAAGAGCCGCCGCTCTCTGCA-CACC-CTTCGTTGGTGGGT
JMFS088F10+ TTC-TC-GCCATGGTTCCTTAAGAGCCGCCGCTCTCAGCA-AACA-CTT
JMFS104G11+ TTC-TC-GCCATGGTGCCTTAAGAGCCGCCGCTCTCTACA-AACA-CTTCGTTGGTGGGT
                      ____________________________________________________________
consensus TTC-TC-ACCATGGTACCTTAAGAGCCGCCGCTCTCTACA-AACA-CTTCGTTGGTGGGT
 
. : . : . : . : . : . :
JMFS095G09+ G
JMFS156B02- GGAGAGAGAGAGAGAGGGAGGACGAGAGCGAGAAGTGCGC
JMFS102B11+ GGAGAGACAGAGAGAGGGAGGACGAGAGCGACAAGTGCGCTTTTTTA
JMFS146E11+ G
JMFS152H12+ GGAGAGAGAAACAGAGGGAGGTCGAGAGCGACGAGCGCGCT
JMFS133H11+ GGAGAGAGAAACAGAGGGAGGTCGAGAGCGACAAGCGCGCTTTTTTA
JMFS168D06+ GGAGAGAGAAACAGAGGGAGGTCGAGAGCGACAAGTGCGCTTTTTTA
JMFS079E08+ GAAGAGAG
JMFS104G11+ GGAGACAGAGAGAGAGGGAGGCCGAGAGCGATAAGTGCGCTTTTTTAGACACAGCAACTG
                      ____________________________________________________________
consensus GGAGAGAGAGAGAGAGGGAGGTCGAGAGCGACAAGTGCGCTTTTTTAGACACAGCAACTG