Previous Contig 003719:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026H06Sequence608003719 (3)gb:AY096651_15761883e-64Arabidopsis thaliana unknown protein (At4g20850) mRNA, partial cds.
JMFS092G07Sequence618003719 (3)gb:AY096651_15761883e-62Arabidopsis thaliana unknown protein (At4g20850) mRNA, partial cds.
JMFS104C09Sequence608003719 (3)gb:AY096651_15761884e-62Arabidopsis thaliana unknown protein (At4g20850) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS026H06+ T
JMFS092G07+ GGCATCCTCACATTTGNCATGT
                      ____________________________________________________________
consensus GGCATCCTCACATTTGNCATGT
 
. : . : . : . : . : . :
JMFS026H06+ TCTTATCAAACTCATCAAGTTGCTTTACAGCCTCCGTGATTGCTTCCTGATTTTTCTCAT
JMFS092G07+ TCTTATCAAACTCATCAAGTTGCTTTACAGCCTCCGTGATTGCTTCCTGATTTTTCTCAT
JMFS104C09+ AAGTTGCTTTACAGCCTCCGTGATTGCTTCCTGATTTTTCTCAT
                      ____________________________________________________________
consensus TCTTATCAAACTCATCAAGTTGCTTTACAGCCTCCGTGATTGCTTCCTGATTTTTCTCAT
 
. : . : . : . : . : . :
JMFS026H06+ CCCACTTTTTTTTTCTTTCTTTCTTCACACGAGAAGTAAGATCATCAGTGAACAGCTCAA
JMFS092G07+ CCCACTTTTTTTTTCTTTCTTTCTTCACACGAGAAGTAAGATCATCAGTGAACAGCTCAA
JMFS104C09+ CCCACTTTTTTTTTCTTTCTTTCTTCACACGAGAAGTAAGATCATCAGTGAACAGCTCAA
                      ____________________________________________________________
consensus CCCACTTTTTTTTTCTTTCTTTCTTCACACGAGAAGTAAGATCATCAGTGAACAGCTCAA
 
. : . : . : . : . : . :
JMFS026H06+ ATACCAATTTGCAACCCACATGCCATTCACCGGATGGATTATTCCACGAAGAATTTACAA
JMFS092G07+ ATACCAATTTGCAACCCACATGCCATTCACCGGATGGATTATTCCACGAAGAATTTACAA
JMFS104C09+ ATACCAATTTGCAACCCACATGCCATTCACCGGATGGATTATTCCACGAAGAATTTACAA
                      ____________________________________________________________
consensus ATACCAATTTGCAACCCACATGCCATTCACCGGATGGATTATTCCACGAAGAATTTACAA
 
. : . : . : . : . : . :
JMFS026H06+ TCAAAGAAGCTCCAGATGCTCCCTGAATGCAACCATCAGCATCAGCCTTCACTACAGTGG
JMFS092G07+ TCAAAGAAGCTCCAGATGCTCCCTGAATGCAACCATCAGCATCAGCCTTCACTACAGTGG
JMFS104C09+ TCAAAGAAGCTCCAGATGCTCCCTGAATGCAACCATCAGCATCAGCCTTCACTACAGTGG
                      ____________________________________________________________
consensus TCAAAGAAGCTCCAGATGCTCCCTGAATGCAACCATCAGCATCAGCCTTCACTACAGTGG
 
. : . : . : . : . : . :
JMFS026H06+ ATGTATCAACATCTCCACTACCAGTACAATCTAACACATCCAGAACTTTTGGTTTCCCAT
JMFS092G07+ ATGTATCAACATCTCCACTACCAGTACAATCTAACACATCCAGAACTTTTGGTTTCCCAT
JMFS104C09+ ATGTATCAACATCTCCACTACCAGTACAATCTAACACATCCAGAACTTTTGGTTTCCCAT
                      ____________________________________________________________
consensus ATGTATCAACATCTCCACTACCAGTACAATCTAACACATCCAGAACTTTTGGTTTCCCAT
 
. : . : . : . : . : . :
JMFS026H06+ CCGATGTCACCTGTAAACCAGCTGCAGCTGGATCAACTCCAGAATCGAAAATTGCGATGA
JMFS092G07+ CCGATGTCACCTGTAAACCAGCTGCAGCTGGATCAACTCCAGAATCGAAAATTGCGATGA
JMFS104C09+ CCGATGTCACCTGTAAACCAGCTGCAGCTGGATCAACTCCAGAATCGAAAATTGCGATGA
                      ____________________________________________________________
consensus CCGATGTCACCTGTAAACCAGCTGCAGCTGGATCAACTCCAGAATCGAAAATTGCGATGA
 
. : . : . : . : . : . :
JMFS026H06+ CGACGCCGCGGCCGTCGTAGTGAGGGTGAGCTTCGATGAAGCGATCGGCGGCGATTTCCT
JMFS092G07+ CGACGCCGCGGCCGTCGTAGTGAGGGTGAGCTTCGATGAAGCGATCGGCGGCGATTTCCT
JMFS104C09+ CGACGCCGCGGCCGTCGTAGTGAGGGTGAGCTTCGATGAAGCGATCGGCGGCGATTTCCT
                      ____________________________________________________________
consensus CGACGCCGCGGCCGTCGTAGTGAGGGTGAGCTTCGATGAAGCGATCGGCGGCGATTTCCT
 
. : . : . : . : . : . :
JMFS026H06+ TCTTAGGCATTTGAGAAGCAAGGAAAGTGGACTCGTTCAGTCTGAAATTGCGCAGAGCTC
JMFS092G07+ TCTTAGGCATTTGAGAAGCAAGGAAAGTGGACTCGTTCAGTCTGAAATTGCGCAGAGCTC
JMFS104C09+ TCTTAGGCATTTGAGAAGCAAGGAAAGTGGACTCGTTCAGTCTGAAATTGCGCAGAGCTC
                      ____________________________________________________________
consensus TCTTAGGCATTTGAGAAGCAAGGAAAGTGGACTCGTTCAGTCTGAAATTGCGCAGAGCTC
 
. : . : . : . : . : . :
JMFS026H06+ CGTTGTCGTCGCCGGAAGTTACAATCGAGGAACAAGTCATGGCCCTACTTCTGCTCAGTC
JMFS092G07+ CGTTGTCGTCGCCGGAAGTTACAATCGAGGAACAAGTCATGGCCCTACTTCTGCTCAGTC
JMFS104C09+ CGTTGTCGTCGCCGGAAGTTACAATCGAGGAACAAGTCATGGCCCTACTTCTGCTCAGTC
                      ____________________________________________________________
consensus CGTTGTCGTCGCCGGAAGTTACAATCGAGGAACAAGTCATGGCCCTACTTCTGCTCAGTC
 
. : . : . : . : . : . :
JMFS026H06+ CCCTCTCTAGAGTTGAGCTACCGCTGCGCTTTTTGGGTGTAATAATGAGTCTTC
JMFS092G07+ CCCTCTCTAGAGTTGAGCTACCGCTGCGCTTTTTGGGTGTAATAATGAGTCTTC
JMFS104C09+ CCCTCTCTAGAGTTGAGCTACCGCTGCGCTTTTTGGGTGTAATAATGAGTCTTCGACCTG
                      ____________________________________________________________
consensus CCCTCTCTAGAGTTGAGCTACCGCTGCGCTTTTTGGGTGTAATAATGAGTCTTCGACCTG