Previous Contig 003717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS017D12Sequence610003717 (3)gb:BT002375_16359785e-34Arabidopsis thaliana expressed protein (At3g03770) mRNA, complete cds.
JMFS104B09Sequence611003717 (3)gb:BT002375_16359781e-19Arabidopsis thaliana expressed protein (At3g03770) mRNA, complete cds.
JMFS112F07Sequence423003717 (3)gb:BT002375_16359783e-12Arabidopsis thaliana expressed protein (At3g03770) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS017D12+ GCAATAA
                      ____________________________________________________________
consensus GCAATAA
 
. : . : . : . : . : . :
JMFS017D12+ ACCACTAAAAGAATTATTCTTTAAACTCAGCACAGTCAAAGCAGGAAGTGAAGCTAACCA
                      ____________________________________________________________
consensus ACCACTAAAAGAATTATTCTTTAAACTCAGCACAGTCAAAGCAGGAAGTGAAGCTAACCA
 
. : . : . : . : . : . :
JMFS017D12+ ATCAGGAACCTGACCTGTGAACCTGTTATTATCCAACACAAGTGTCTGAAGCCCCTTCAA
JMFS104B09+ AGCCCCTTCAA
                      ____________________________________________________________
consensus ATCAGGAACCTGACCTGTGAACCTGTTATTATCCAACACAAGTGTCTGAAGCCCCTTCAA
 
. : . : . : . : . : . :
JMFS017D12+ AGATGAAATCTCCAATGGAAGGCTGCCATTAAAGGAGTTTGAGCTTATATTCACAATCTC
JMFS104B09+ AGATGAAATCTCCAATGGAAGGCTGCCATTAAAGGAGTTTGAGCTTATATTCACAATCTC
                      ____________________________________________________________
consensus AGATGAAATCTCCAATGGAAGGCTGCCATTAAAGGAGTTTGAGCTTATATTCACAATCTC
 
. : . : . : . : . : . :
JMFS017D12+ CAAAGAAGACAAAAGCCCAATACTTGGAGGCAAAGGGCCTCTCAGACCCAAAGAAACTAA
JMFS104B09+ CAAAGAAGACAAAAGCCCAATACTTGGAGGCAAAGGGCCTCTCAGACCCAAAGAAACTAA
                      ____________________________________________________________
consensus CAAAGAAGACAAAAGCCCAATACTTGGAGGCAAAGGGCCTCTCAGACCCAAAGAAACTAA
 
. : . : . : . : . : . :
JMFS017D12+ AGAGAGGACCTTCAAGTTAGGGAGGCTAGCAAGATTGGAGAAGAGGAAAGAAGTGGAAAT
JMFS104B09+ AGAGAGGACCTTCAAGTTAGGGAGGCTAGCAAGATTGGAGAAGAGGAAAGAAGTGGAAAT
                      ____________________________________________________________
consensus AGAGAGGACCTTCAAGTTAGGGAGGCTAGCAAGATTGGAGAAGAGGAAAGAAGTGGAAAT
 
. : . : . : . : . : . :
JMFS017D12+ CTCTTGAGGAAATTGAGGGAAAACCCCATTCCCAGCCACATGGAGCTGTGTTATGTTATC
JMFS112F07+ GAAAACCCCATTCCCAGCCACATGGAGCTGTGTTATGTTATC
JMFS104B09+ CTCTTGAGGAAATTGAGGGAAAACCCCATTCCCAGCCACATGGAGCTGTGTTATGTTATC
                      ____________________________________________________________
consensus CTCTTGAGGAAATTGAGGGAAAACCCCATTCCCAGCCACATGGAGCTGTGTTATGTTATC
 
. : . : . : . : . : . :
JMFS017D12+ TTCATAGCACACCAGTGTTAGGATTGGGAGTGGCTCAGTGTTGCAGAAATCTGAGTTCTC
JMFS112F07+ TTCATAGCACACCAGTGTTAGGATTGGGAGTGGCTCAGTGTTGCAGAAATCTGAGTTCTC
JMFS104B09+ TTCATAGCACACCAGTGTTAGGATTGGGAGTGGCTCAGTGTTGCAGAAATCTGAGTTCTC
                      ____________________________________________________________
consensus TTCATAGCACACCAGTGTTAGGATTGGGAGTGGCTCAGTGTTGCAGAAATCTGAGTTCTC
 
. : . : . : . : . : . :
JMFS017D12+ ACTCCAACTGCTTAGCTCCACTGGGAAGCTCAGCTCCTGTTTGATCCTCTGAATGGCTTG
JMFS112F07+ ACTCCAACTGCTTAGCTCCACTGGGAAGCTCAGCTCCTGTTTGATCCTCTGAATGGCTTG
JMFS104B09+ ACTCCAACTGCTTAGCTCCACTGGGAAGCTCAGCTCCTGTTTGATCCTCTGAATGGCTTG
                      ____________________________________________________________
consensus ACTCCAACTGCTTAGCTCCACTGGGAAGCTCAGCTCCTGTTTGATCCTCTGAATGGCTTG
 
. : . : . : . : . : . :
JMFS017D12+ GAACTGGGAAGGTGGGAGCATTTGCTCTGAGTAATCCACCATGGCAAAAAACAAGAAAAG
JMFS112F07+ GAACTGGGAAGGTGGGAGCATTTGCTCTGAGTAATCCACCATGGCAAAAAACAAGAAAAG
JMFS104B09+ GAACTGGGAAGGTGGGAGCATTTGCTCTGAGTAATCCACCATGGCAAAAAACAAGAAAAG
                      ____________________________________________________________
consensus GAACTGGGAAGGTGGGAGCATTTGCTCTGAGTAATCCACCATGGCAAAAAACAAGAAAAG
 
. : . : . : . : . : . :
JMFS017D12+ TAATAAGAGCTTTAATGGCTTCTTCTTCTTCTTCTTCTTCAGCACCTCTGCCATAGCTAA
JMFS112F07+ TAATAAGAGCTTTAATGGCTTCTTCTTCTTCTTCTTCTTCAGCACCTCTGCCATAGCTAA
JMFS104B09+ TAATAAGAGCTTTAATGGCTTCTTCTTCTTCTTCTTCTTCAGCACCTCTGCCATAGCTAA
                      ____________________________________________________________
consensus TAATAAGAGCTTTAATGGCTTCTTCTTCTTCTTCTTCTTCAGCACCTCTGCCATAGCTAA
 
. : . : . : . : . : . :
JMFS017D12+ TTC
JMFS112F07+ TTCCTTTCCACTTCCTTGTTGTGATTTGGGTTCTTGATTTTATTTATTTATAATGCTTTT
JMFS104B09+ TTCCTTTCCACTTCCTTGTTGTGATTTGGGTTCTTGATTTTATTTATTTATAATGCTTTT
                      ____________________________________________________________
consensus TTCCTTTCCACTTCCTTGTTGTGATTTGGGTTCTTGATTTTATTTATTTATAATGCTTTT
 
. : . : . : . : . : . :
JMFS112F07+ TGCCTTTTGGGTGTTTTATTTGCTTTCAAGAAACAGTGGAGACTATAA
JMFS104B09+ TGCCTTTTGGGTGTTTTATTTGCTTTCAAGAAACAGTGGAGACTATAATCTATAAGAAAA
                      ____________________________________________________________
consensus TGCCTTTTGGGTGTTTTATTTGCTTTCAAGAAACAGTGGAGACTATAATCTATAAGAAAA