Previous Contig 003711:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036C13Sequence517003711 (7)gb:AY579888_16160303e-06Lycopersicon esculentum AML1 mRNA, complete cds.607009893 (2)gb:AY579888_16160301e-57Lycopersicon esculentum AML1 mRNA, complete cds.
JMFS020D06Sequence627003711 (7)
JMFS082H06Sequence613003711 (7)
JMFS103D06Sequence560003711 (7)
JMFS119F11Sequence627003711 (7)
JMFS125E07Sequence563003711 (7)gb:AY579888_16160308e-12Lycopersicon esculentum AML1 mRNA, complete cds.
JMSF025L09Sequence677003711 (7)620009893 (2)gb:AP007253_18634069e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS125E07+ GTAAAT
                      ____________________________________________________________
consensus GTAAAT
 
. : . : . : . : . : . :
JMFS125E07+ AAGAATTAGGAAGCTCATAACCTTNTGTCATCTGACAACCCATAGGTATCTGGTTCTCAA
                      ____________________________________________________________
consensus AAGAATTAGGAAGCTCATAACCTTNTGTCATCTGACAACCCATAGGTATCTGGTTCTCAA
 
. : . : . : . : . : . :
JMFS125E07+ AAGGCAATGAAGGAACACTTCCTACTCTGAATGTTCTGTCTGTTTTCAGACCATTGAAAT
JMFF036C13+ CTGAATGTTCTGTCTGTTTTCAGACCATTGAAAT
                      ____________________________________________________________
consensus AAGGCAATGAAGGAACACTTCCTACTCTGAATGTTCTGTCTGTTTTCAGACCATTGAAAT
 
. : . : . : . : . : . :
JMFS125E07+ TATGCAGGCTATTTGACTTCCAATACCCATTCTGGCTCTCATCATGAAAACGCAAGTCCT
JMFF036C13+ TATGCAGGCTATTTGACTTCCAATACCCATTCTGGCTCTCATCATGAAAACGCAAGTCCT
                      ____________________________________________________________
consensus TATGCAGGCTATTTGACTTCCAATACCCATTCTGGCTCTCATCATGAAAACGCAAGTCCT
 
. : . : . : . : . : . :
JMFS125E07+ CAGAAAAGAAGGACGGAGACAAATCCTGTGGGTCCATCATCTGGGAAGGCATTATGCAAT
JMFF036C13+ CAGAAAAGAAGGACGGAGACAAATCCTGTGGGTCCATCATCTGGGAAGGCATTATGCAAT
JMFS082H06+ ATCCTGTGGGTCCATCATCTGGGAAGGCATTATGCAAT
JMFS119F11+ ATCTGGGAAGGCATTATGCAAT
                      ____________________________________________________________
consensus CAGAAAAGAAGGACGGAGACAAATCCTGTGGGTCCATCATCTGGGAAGGCATTATGCAAT
 
. : . : . : . : . : . :
JMFS125E07+ CTGGACTGAAAAAGCACTAGAAAAACTCAACAGAAGACAAATAGCATTCGCTTTCACCAA
JMFF036C13+ CTGGACTGAAAAAGCACTAGAAAAACTCAACAGAAGACAAATAGCATTCGCTTTCACCAA
JMFS082H06+ CTGGACTGAAAAAGCACTAGAAAAACTCAACAGAAGACAAATAGCATTCGCTTTCACCAA
JMFS119F11+ CTGGACTGAAAAAGCACTAGAAAAACTCAACAGAAGACAAATAGCATTCGCTTTCACCAA
                      ____________________________________________________________
consensus CTGGACTGAAAAAGCACTAGAAAAACTCAACAGAAGACAAATAGCATTCGCTTTCACCAA
 
. : . : . : . : . : . :
JMFS125E07+ CAATCAAATACACCCAATTGTAGGAAAAATCAGCAATGTCCTGCTTCAAAGAGCTTTTAG
JMFF036C13+ CAATCAAATACACCCAATTGTAGGAAAAATCAGCAATGTCCTGCTTCAAAGAGCTTTTAG
JMFS082H06+ CAATCAAATACACCCAATTGTAGGAAAAATCAGCAATGTCCTGCTTCAAAGAGCTTTTAG
JMFS119F11+ CAATCAAATACACCCAATTGTAGGAAAAATCAGCAATGTCCTGCTTCAAAGAGCTTTTAG
                      ____________________________________________________________
consensus CAATCAAATACACCCAATTGTAGGAAAAATCAGCAATGTCCTGCTTCAAAGAGCTTTTAG
 
. : . : . : . : . : . :
JMFS125E07+ AGTATGAACATCATTGGTGGGACACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
JMFF036C13+ AGTATGAACATCATTGGTGGGACACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
JMFS082H06+ AGTATGAACATCATTGGTGGGACACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
JMFS119F11+ AGTATGAACATCATTGGTGGGACACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
JMSF025L09+ ACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
                      ____________________________________________________________
consensus AGTATGAACATCATTGGTGGGACACAAAATGCGAGAGCAAGTTCCCAGAAACAAAATTCG
 
. : . : . : . : . : . :
JMFS125E07+ CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
JMFF036C13+ CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
JMFS082H06+ CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
JMFS119F11+ CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
JMFS020D06+ GGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
JMSF025L09+ CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
                      ____________________________________________________________
consensus CAGAGGGAGCAAGGGTCACAACGGCAAAGGAGATTTTATAGGAAAGGAAATGGATGCTTA
 
. : . : . : . : . : . :
JMFS125E07+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMFF036C13+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMFS082H06+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMFS119F11+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMFS020D06+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMSF025L09+ GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
JMFS103D06+ GGAAGGAAGATTGAAGAAGC
                      ____________________________________________________________
consensus GAGAGAAAACGAGAATAAATTATGGCAAAAGGCAAGGGAAGGAAGGAAGATTGAAGAAGC
 
. : . : . : . : . : . :
JMFS125E07+ GATCTAGGTGAATGTGT
JMFF036C13+ GATATAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
JMFS082H06+ GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
JMFS119F11+ GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
JMFS020D06+ GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
JMSF025L09+ GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
JMFS103D06+ GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
                      ____________________________________________________________
consensus GATCTAGGTGAATGTGTTCCGTGCAAGAACCACCAAAGCTTGGATGCCTTCCTCTCTCCG
 
. : . : . : . : . : . :
JMFF036C13+ TG
JMFS082H06+ TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
JMFS119F11+ TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
JMFS020D06+ TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
JMSF025L09+ TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
JMFS103D06+ TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
                      ____________________________________________________________
consensus TGCCTCGTTATTTCTACAATGCACGTTAACGGAATGAATTCTCTGAATATATTATCTCCG
 
. : . : . : . : . : . :
JMFS082H06+ GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
JMFS119F11+ GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
JMFS020D06+ GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
JMSF025L09+ GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
JMFS103D06+ GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
                      ____________________________________________________________
consensus GTTTCCTCTCGGTATATATGTCCCTTTTACAACAGGCCGGTCTCTTTATTCCTCGGCAAG
 
. : . : . : . : . : . :
JMFS082H06+ CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
JMFS119F11+ CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
JMFS020D06+ CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
JMSF025L09+ CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
JMFS103D06+ CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
                      ____________________________________________________________
consensus CGCTCCTCCTCGATCGGAAACTCCCGAGCTCCAGCGAGCGATGGACGGCGGTAATTCCAA
 
. : . : . : . : . : . :
JMFS082H06+ GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCT
JMFS119F11+ GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCTGTTTTGCACAGAGAGGGAAAGAGAG
JMFS020D06+ GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCTGTTTTGCACAGAGAGGGAAAGAGAG
JMSF025L09+ GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCTGTTTTGCACAGAGAGGGAAAGAGAG
JMFS103D06+ GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCTGTTTTGCACAGAGAGGGAAAGAGAG
                      ____________________________________________________________
consensus GCCCCTCGCTCGCACTTGCTCTCTCCTCCTGCTCTGTTTTGCACAGAGAGGGAAAGAGAG
 
. : . : . : . : . : . :
JMFS119F11+ AGGGA
JMFS020D06+ AGGGAGAGACACAGGGAGAGAACGAGGGAGGGAGCAAATAAGCAAATTGGAGATACAATA
JMSF025L09+ AGGGAGAGACACAGGGAGAGAACGAGGGAGGGAGCAAATAAGCAAATTGGAGATACAATA
JMFS103D06+ AGGGAGAGACACAGGGAGAGAACGAGGGAGGGAGCAAATAAGCAAATTGGAGATACAATA
                      ____________________________________________________________
consensus AGGGAGAGACACAGGGAGAGAACGAGGGAGGGAGCAAATAAGCAAATTGGAGATACAATA
 
. : . : . : . : . : . :
JMFS020D06+ CAAATAGAAAATTCGGAGATCGCTTGGCCGTCGATTATAATTGAAACTGACAGCACCGTA
JMSF025L09+ CAAATAGAAAATTCGGAGATCGCTTGGCCGTCGATTATAATTGAAACTGACAGCACCGTA
JMFS103D06+ CAAATAGAAAATTCGGAGATCGCTTGGCCGTCGATTATAATTGAAACTGACAGCACCGTA
                      ____________________________________________________________
consensus CAAATAGAAAATTCGGAGATCGCTTGGCCGTCGATTATAATTGAAACTGACAGCACCGTA
 
. : . : . : . : . : . :
JMFS020D06+ CAAAATTGATAAAAAAGGAGAAAATTATGGCGGAGGAGTGTAAAGGAAGACCTGGTCACC
JMSF025L09+ CAAAATTGATAAAAAAAGAGGAAATTATGGCGGAGGAGTGTAAAGGAAGACCTGGTCACC
JMFS103D06+ CAAAATTGATAAAAAAGGAGAAAATTATGGCGGAGGAGTGTAAAGGAAGACCTGGTCACC
                      ____________________________________________________________
consensus CAAAATTGATAAAAAAGGAGAAAATTATGGCGGAGGAGTGTAAAGGAAGACCTGGTCACC
 
. : . : . : . : . : . :
JMFS020D06+ AGAAACGCTCCTACGCGAGGATCTCCGATGAG
JMSF025L09+ AGAAACGCTCCTACGCGAGGATCTCCGATGAGCTAGCTC
JMFS103D06+ AGAAACGCTCCTACGCGAGGATCTCCGATGAGCTAGCTCATCTATCAATCACAGGAGAGA
                      ____________________________________________________________
consensus AGAAACGCTCCTACGCGAGGATCTCCGATGAGCTAGCTCATCTATCAATCACAGGAGAGA